SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16831
Pre Gene Modal
BGIBMGA005626
Annotation
PREDICTED:_zinc_finger_protein_with_KRAB_and_SCAN_domains_1_isoform_X4_[Bombyx_mori]
Transcription factor
Location in the cell
Nuclear   Reliability : 4.671
 

Sequence

CDS
ATGGGCGAGGGTGGCATGCAGTATGTCCGGTCGCTGGACGGCGGCACCAGTTTGCAGCCCACTCCTCAACTCATCTCCGTGCCTATAGCGTTGCCCGGAGTCAAACCTGGTGATCCGCAACCAACGGTGCAAATACAGGTGCTCAATCCGAATCTACTACAAACTCAGCAACAACCGAAATATCATATGCAAATACCCATACAGGGATTACAGAATGGGCTCCAAGTATTAACCGCTCTCTCACCAGATCTGCAAGTTATACAGCCTTCACAAACTCGAACACATGACAGTGAACATAACCAGCCTACTATGCATCAGGTATTCATAACACCGAACCAACAGATTATTATAAATGGTCCGGATAAAGCTTTGAACAACAACACAGACAACAATAATCCGAACATCACTAATATTACCATCAAAGAGGAATGTGAAGAAAACATTGATGATGAAAGTTCACAAGGGACTGAGACAAGTGACAGTATGTCATATCCATCGAACCCCAGTGATGAGGCGCTGCTAATAAAGTACCTCAACCAATTTCCGCAGGAAAAACAATCATTGCCTGCTTCTCTACAACAGTTCTTAAGGCTGAAACATACTGAGGCAAAAAAGCAGATGATCGAAGTTGAAGTTCCACCAGAGCACGACAAAACAGTCGAGGCCGTCGCTGAAGCCATTCTCAGTGAAGACGGCACTTTAAGAATAAAAAGCAAGAAAAGAAAGAAATACAAAAAGAAGCCAAGTAAACCGGCCCGACCGAAGCCAGGGCAGGTTGTCATAGCGACTGCCGCCGATGGAACACCCATATATTGCTGTCCAGAATGTCAGATGGCATACCGAGAAAAGGATGAACTGGAACAACACCTTAGTGTTCACAAGATCGAGAGGAGATTTATATGTGGAATCTGTGGCGCTGGCTTGAAACGCAAAGAGCATCTAGAGAGACACAAGCTAGGACACAACCCGGAGCGGCCCTACGTGTGCTCCGTCTGCACCAAGGGCTTCAAGCGACGGAACATCTCAACCTCCACGCCGTGCTGCACTCCGGGGTCAAGACTGAGATATGCGGAGAATGCGGGAAAGGCTTCTACCGTAAGGATCACCTCCGCAAGCACACACGGTCGCACGAGAGTAAGCGAGCTCGCGAGCAAGCAGACGCGGCTACTGCTGAGAAGCCACAACCTGCCAACAACAATACTTCTAGTATACCCGAGATCACCATTCATGTTTAATTCCAACGAGTTCAAGCATGCAAGTGCCCATCGAGATAAACATCCCCCAGCACCTCGTGACGTCACTGGCGTCAGCGCAGCAGCAGCAGCAGCAGCAGCAACAAGCACACGAAACACTGGACGCCCTATTGGCCCAACACACCTGACACTCTGCTTAGCGGCCGCCCACACCGACGGGGAAACTCACACCATGCCTTCGATCCCAGCCCTAGATAAATGGGTAAATGCATAG
Protein
MGEGGMQYVRSLDGGTSLQPTPQLISVPIALPGVKPGDPQPTVQIQVLNPNLLQTQQQPKYHMQIPIQGLQNGLQVLTALSPDLQVIQPSQTRTHDSEHNQPTMHQVFITPNQQIIINGPDKALNNNTDNNNPNITNITIKEECEENIDDESSQGTETSDSMSYPSNPSDEALLIKYLNQFPQEKQSLPASLQQFLRLKHTEAKKQMIEVEVPPEHDKTVEAVAEAILSEDGTLRIKSKKRKKYKKKPSKPARPKPGQVVIATAADGTPIYCCPECQMAYREKDELEQHLSVHKIERRFICGICGAGLKRKEHLERHKLGHNPERPYVCSVCTKGFKRRNISTSTPCCTPGSRLRYAENAGKASTVRITSASTHGRTRVSELASKQTRLLLRSHNLPTTILLVYPRSPFMFNSNEFKHASAHRDKHPPAPRDVTGVSAAAAAAAATSTRNTGRPIGPTHLTLCLAAAHTDGETHTMPSIPALDKWVNA

Summary

Pfam
PF00096   zf-C2H2
Interpro
IPR036236   Znf_C2H2_sf        + More
IPR013087   Znf_C2H2_type       
SUPFAM
SSF57667   SSF57667       
PDB
5EI9     E-value=1.60049e-10,     Score=160

Ontologies

Topology

Length:
488
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00178
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00257
outside
1  -  488
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号