SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16570
Pre Gene Modal
BGIBMGA005626
Annotation
PREDICTED:_zinc_finger_protein_with_KRAB_and_SCAN_domains_1_isoform_X4_[Bombyx_mori]
Transcription factor
Location in the cell
Nuclear   Reliability : 4.651
 

Sequence

CDS
ATGTCATATCCATCGAACCCCAGTGATGAGGCGCTGCTAATAAAGTACCTCAACCAATTTCCGCAGGAAAAACAATCATTGCCTGCTTCTCTACAACAGTTCTTAAGGCTGAAACATACTGAGGCAAAAAAGCAGATGATCGAAGTTGAAGTTCCACCAGAGCACGACAAAACAGTCGAGGCCGTCGCTGAAGCCATTCTCAGTGAAGACGGCACTTTAAGAATAAAAAGCAAGAAAAGAAAGAAATACAAAAAGAAGCCAAGTAAACCGGCCCGACCGAAGCCAGGGCAGGTTGTCATAGCGACTGCCGCCGATGGAACACCCATATATTGCTGTCCAGAATGTCAGATGGCATACCGAGAAAAGGATGAACTGGAACAACACCTTAGTGTTCACAAGATCGAGAGGAGATTTATATGTGGAATCTGTGGCGCTGGCTTGAAACGCAAAGAGCATCTAGAGAGACACAAGCTAGGACACAACCCGGAGCGGCCCTACGTGTGCTCCGTCTGCACCAAGGGCTTCAAGCGACGGGAACATCTCAACCTCCACGCCGTGCTGCACTCCGGGGTCAAGACTGAGATATGCGGAGAATGCGGGAAAGGCTTCTACCGTAAGGATCACCTCCGCAAGCACACACGGTCGCACGAGAGTAAGCGAGCTCGCGAGCAAGCAGACGCGGCTACTGCTGAGAAGCCACAACCTGCCAACAACAATACTTCTAATTCCAACGAGTTCAAGCATGCAAGTGCCCATCGAGATAAACATCCCCCAGCACCTCGTGACGTCACTGGCGTCAGCGCAGCAGCAGCAGCAGCAGCAGCAACAAGCACACGAAACACTGGACGCCCTATTGGCCCAACACACCTGACACTCTGCTTAGCGGCCGCCCACACCGACGGGGAAACTCACACCATGCCTTCGATCCCAGCCCTAGATAAATGGATCGCGCGGCCCGCTCGTCGCTCCCGCTTCCGCTTGTCACCGGGCACTCACTCTGAATGCGCGCCGGACTTCGAGTCTTTATAA
Protein
MSYPSNPSDEALLIKYLNQFPQEKQSLPASLQQFLRLKHTEAKKQMIEVEVPPEHDKTVEAVAEAILSEDGTLRIKSKKRKKYKKKPSKPARPKPGQVVIATAADGTPIYCCPECQMAYREKDELEQHLSVHKIERRFICGICGAGLKRKEHLERHKLGHNPERPYVCSVCTKGFKRREHLNLHAVLHSGVKTEICGECGKGFYRKDHLRKHTRSHESKRAREQADAATAEKPQPANNNTSNSNEFKHASAHRDKHPPAPRDVTGVSAAAAAAAATSTRNTGRPIGPTHLTLCLAAAHTDGETHTMPSIPALDKWIARPARRSRFRLSPGTHSECAPDFESL

Summary

Pfam
PF00096   zf-C2H2
Interpro
IPR036236   Znf_C2H2_sf        + More
IPR013087   Znf_C2H2_type       
SUPFAM
SSF57667   SSF57667       
ProteinModelPortal
PDB
5EI9     E-value=3.50427e-18,     Score=224

Ontologies

Topology

Length:
342
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0004
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00750
outside
1  -  342
 
 

Population Genetic Test Statistics

Pi
30.523009
Theta
36.13058
Tajima's D
-0.542398
CLR
0.000383
CSRT
0.234538273086346
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号