SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16514
Pre Gene Modal
BGIBMGA009653
Annotation
PREDICTED:_transcription_factor_CP2-like_protein_1_isoform_X1_[Bombyx_mori]
Transcription factor
Location in the cell
Nuclear   Reliability : 4.153
 

Sequence

CDS
ATGGAATATACGGAATATAGAGACTTTACAATGCATGACGTACGTAAAGAGGAGTACGGCTGGGAATCTACAGTTAGACTCATGGTCGGGAGGGAGGACGAATTGGGCATGTACCTGGAGGAGAGCAGGGAGGGCAGGAAGCGGAAGTGGCAGCCCGAGAAAATGAGGCGAGACGGCAGCGAAGATAAAGATCAGAAGAAGGTGCCGCCGAAGAAGATCATGGCTGCCCTAAGCGAGATAGGCGGGAGCGGCACAAGCTCCTCATCCTCGCATTTGTCTCCGGCATGGCAAGTCAACGAGCTCGATCTGGACTTACCCGTCGAACTATCCATGAACGAAGCGCTGTTGTCGCTTCCATCGCTGGCGGTGTTCAAACAGGAGGCTCCGTCTCCGACGGGCGCGGTGCTCTCGCCCCCCCGCCGCCACTGGCCCGTCCCCCGACGGAACGACGATCGGCAGATGACAAGCATGGTTGTCGACGGAGCCCGTGACGGCATGGACGAGTGCCAGCAGTCGCCTTCCCACAACGGAAACGCTATGCAGCATGGAAGTCCCGACGCCTTGCAGTGCCAACAGCAGATGCCGCCGAGCGCCGTCATGCCAATGAACGGTTACCATTCACCAAACGAACACGAGAATAAAAACGCTGGTCTGCTGATCTGCTCTCCGGTGGGCTCGCTGGAAGGCTACCTGCACTCTCCACCACACCTGCAGCAGCGTTCCGACTCCAGCTTCAAGGATGACACCAGGTTCCAGTACGTTCTGGCCGCAGCGACTTCGATAGCAACCAAACAGAACGAGGAAACCCTGACCTACCTCAACCAAGGCCAGTCCTACGAGATCAAGCTCAAGAAGCTCGGTGACTTGTCACATTACAAAGGAAAGCTGCTTAAAAGTGTCATCAAGATATGCTTCCACGAGCGCCGCTTGCAGTACATGGAAAGGGAGCAGATAGCGCAGTGGCACGCCGAGAGGCCGGGGGAGAGGATCGTAGAGGTGGACGTGCCTCTCTCGTACGGCATTATAAAAGTGGAACAATCCACAGCACTGAACGCGCTCCACGTCTACTGGGACGCTACCAAGGACGTGGGTGTTTATATAAAGGTATTCAAATTGAAAGGCGCCGATCGCAAACACAAACAGGACAGGGAGAAGGTGCTGCGCAGACCGAGGGCCGATCTGGACAAGTACCAGCCCGCCTGCGAGGCCACTGTGCTGACTACGTTGTCACATGACGCGCTGATGCCGCCGCCCTCGCTGGTCACCACCTCGCCGTCCTACTCGCCAGAGCTGTGTGTGACACCTAAATCTGCCTCGAGCCCTATCGCTACCAAGCCGATTTCTCAACCAGCCATCGTTGGTACTACTAATCAAATGAAGCCGCTGTATTGTCAAGATGCTGGTGAGATGAAGGTGAGCAGCCCAACCTGCCACTCCCCAGGAGCTATCCTGCCTGACCTACCACAGCCTGCTGAGGAACCAGACAAGAACTTTGGATTATCAAAAGATGCCACCTCCGCCGAGACTCAGGTGTGGTTGTCCCGACAACGGTTCATGCAACACGCCGCCACGTTCGCGAACTTTTCCGGGGCTGATCTGCTGAGACTATCCCGTGATGACATTATCCAGATCGTCGGACTGGCTGATGGCATACGTCTGTTCAACGCACTTCACGCCAAACGCATCTCGCCGCGCCTCACCCTGTACGTGTGCCCGCCCTCCTCCGACGTGCACTGCGCGCTCTACCTGCACGCGTGTCGCGCGCACGAGCTGCTGCACAAGCTGAACGCGCTGCAGGGAGCCGGCAGCAAGGATTGCGAAACCGTATTGGTGTCCGGTCCGAACGGCGCTCGCGTCCGCCTCACCGACGAGCTGGTGCGACATCTGCCAGACAACTCCACCTATCGCCTCAAGAGACTCGAAGACTGCAACGCTCTGCTCCTAAGCGCCACCACCGGCAACTGA
Protein
MEYTEYRDFTMHDVRKEEYGWESTVRLMVGREDELGMYLEESREGRKRKWQPEKMRRDGSEDKDQKKVPPKKIMAALSEIGGSGTSSSSSHLSPAWQVNELDLDLPVELSMNEALLSLPSLAVFKQEAPSPTGAVLSPPRRHWPVPRRNDDRQMTSMVVDGARDGMDECQQSPSHNGNAMQHGSPDALQCQQQMPPSAVMPMNGYHSPNEHENKNAGLLICSPVGSLEGYLHSPPHLQQRSDSSFKDDTRFQYVLAAATSIATKQNEETLTYLNQGQSYEIKLKKLGDLSHYKGKLLKSVIKICFHERRLQYMEREQIAQWHAERPGERIVEVDVPLSYGIIKVEQSTALNALHVYWDATKDVGVYIKVFKLKGADRKHKQDREKVLRRPRADLDKYQPACEATVLTTLSHDALMPPPSLVTTSPSYSPELCVTPKSASSPIATKPISQPAIVGTTNQMKPLYCQDAGEMKVSSPTCHSPGAILPDLPQPAEEPDKNFGLSKDATSAETQVWLSRQRFMQHAATFANFSGADLLRLSRDDIIQIVGLADGIRLFNALHAKRISPRLTLYVCPPSSDVHCALYLHACRAHELLHKLNALQGAGSKDCETVLVSGPNGARVRLTDELVRHLPDNSTYRLKRLEDCNALLLSATTGN

Summary

EMBL
KQ971354    KYB26457.1    GEZM01062471    GEZM01062470    JAV69706.1    NEVH01019077    + More
PNF22878.1    GEZM01062469    JAV69708.1    PNF22880.1    PNF22879.1    GALX01003456    JAB65010.1    GFDF01007959    JAV06125.1    GFDF01007958    JAV06126.1    GFDF01007960    JAV06124.1    GFDF01007961    JAV06123.1    JR036111    AEY56924.1    GEDC01014135    GEDC01012621    GEDC01010142    JAS23163.1    JAS24677.1    JAS27156.1    GECZ01013467    GECZ01008897    GECZ01006525    GECZ01005691    JAS56302.1    JAS60872.1    JAS63244.1    JAS64078.1    JR036104    AEY56920.1    JR036108    AEY56922.1    LBMM01000662    KMQ97851.1    NNAY01000542    OXU27781.1    AJWK01013295    AJWK01013296    AJWK01013297    AJWK01013298    AJWK01013299    AJWK01013300    AJWK01013301    AJWK01013302    AJWK01013303    AJWK01013304    ADTU01008785    ADTU01008786    ADTU01008787    ADTU01008788    ADTU01008789    GDIP01203775    JAJ19627.1    GDIP01115378    JAL88336.1    GDIP01128721    JAL74993.1    GDIP01116868    JAL86846.1    GDIP01215164    JAJ08238.1    GDIP01222714    JAJ00688.1    GDIQ01120372    JAL31354.1    GDIP01231716    JAI91685.1    GDIP01230410    JAI92991.1    GDIP01183118    JAJ40284.1    GDIP01231717    JAI91684.1    GDIP01217563    JAJ05839.1    GDIP01111333    GDIP01052153    LRGB01000918    JAL92381.1    KZS15144.1    GDIQ01118567    JAL33159.1    GDIQ01122974    JAL28752.1    GDIQ01100787    JAL50939.1    GDIQ01058494    JAN36243.1    GDIP01053298    JAM50417.1    GDIQ01177245    GDIQ01055845    GDIQ01055844    JAK74480.1    GDIQ01120371    JAL31355.1    GDIP01221630    JAJ01772.1    GDIP01209921    JAJ13481.1    GDIP01064744    JAM38971.1    GDIQ01051999    JAN42738.1    GDIP01137132    JAL66582.1    GDIP01191219    JAJ32183.1    GDIP01193369    JAJ30033.1    GDIP01215163    JAJ08239.1    GDIP01097842    JAM05873.1    GDIQ01051998    JAN42739.1    GDIP01115379    JAL88335.1    GDIQ01016597    JAN78140.1    GDIP01215162    JAJ08240.1    GDIP01025103    JAM78612.1    GDIP01078930    JAM24785.1    GDIP01191218    JAJ32184.1    GDIQ01112016    JAL39710.1    GECL01002910    JAP03214.1    GDIP01191220    JAJ32182.1    GFTR01007341    JAW09085.1    CVRI01000042    CRK95673.1    GBHO01035091    GBHO01005953    GBHO01005947    GBRD01007938    GBRD01007937    JAG08513.1    JAG37651.1    JAG37657.1    JAG57883.1    GBHO01005951    GBHO01005949    GBHO01005948    GBRD01007941    GBRD01007940    JAG37653.1    JAG37655.1    JAG37656.1    JAG57880.1    GGLE01004261    MBY08387.1   
Pfam
PF04516   CP2        + More
PF18016   SAM_3
PF00642   zf-CCCH
PF00383   dCMP_cyt_deam_1
Interpro
IPR041418   SAM_3        + More
IPR040167   TF_CP2-like       
IPR007604   CP2       
IPR013761   SAM/pointed_sf       
IPR016193   Cytidine_deaminase-like       
IPR001841   Znf_RING       
IPR036855   Znf_CCCH_sf       
IPR002125   CMP_dCMP_dom       
IPR000571   Znf_CCCH       
IPR013083   Znf_RING/FYVE/PHD       
SUPFAM
SSF47769   SSF47769        + More
SSF53927   SSF53927       
SSF90229   SSF90229       
Gene 3D
PDB
5MR7     E-value=3.92738e-09,     Score=149

Ontologies

Topology

Length:
654
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00471
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00086
outside
1  -  654
 
 

Population Genetic Test Statistics

Pi
2.531975
Theta
21.371832
Tajima's D
-1.752018
CLR
0.001902
CSRT
0.0313484325783711
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号