SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16507
Pre Gene Modal
BGIBMGA004545
Annotation
PREDICTED:_transcriptional_activator_cubitus_interruptus_[Bombyx_mori]
Transcription factor
Location in the cell
Nuclear   Reliability : 4.122
 

Sequence

CDS
ATGACGGCGGCTGTTCTTTGCCCCGTCGTCTGGGTGGACTGCAAGCTTGAATTTCCCACTCAAGATGATTTGGTGAAGCATATCAATACGGACCACATACACGCCAGCAAGAAGGCGTTCGTCTGCCGCTGGGTCGGCTGTTCCCGAGACGAAAAGCCTTTCAAAGCCCAATACATGCTTGTCGTTCACATGAGGAGGCACACTGGAGAGAAACCTCATAAGTGCACTTTCGAAGGCTGCTGCAAAGCGTACTCCAGGCTGGAAAACCTGAAGACCCACCTCCGGTCGCACACTGGAGAGAAACCGTACACCTGCGAGTATCCGGGGTGCGCTAAAGCTTTTTCCAACGCGAGCGACAGAGCTAAACATCAAAACAGAACGCACAGTAATGAGAAACCGTACGTCTGTAAAGCGCCGGGCTGCACCAAGAGGTACACCGACCCCTCCTCGCTCCGGAAACACGTGAAAACCGTTCACGGAGCCGAGTTCTACGCGAGTAAGAAACATAAGGGTTGCACGAGAGGTGACGACTCCGCGGAGTCTGGCGGCGGTGGCGCAGGGTCGTCTCCTCGTTCGGAGGAAGGCGGAGTACCACCCGCGATCCGGGGTCACACATCATCGGCGTCCGTCAAGAGCGAGAGTCCCGCGTCGCCCATACCGCACGGCTTGCACACTTCCGCCCACCAGTTGTCTGCGCAATGCGGTGGGGAGCTGGACTTCGGCGGCGGCCTGGGAGGATACCGGGATGAAAACGGCCTGCCGTACTTCAGATTAGACGGAGAGATCGAGCAGGAAGTGGTCGGTGAAGTGGGACAGTTGCCGCTGATGCTGCGAGCTATGGTCGCTATCGGCGAGCCCCGCGCCGCCCCGCACGCCCCCCGCCTCGGGAACAAGATGGCGCTCGCGAGGATGCCACCGCCACACGCCGACCTCGGAGGAGGCGGGGTCACGGGGAGGACAGAGCTGGGCAGCACCAACGTTGGGGTGGAACTGAAGACCGGGGCCTCTAACACGAGGCGCGATTCTGGAATCTCAAGCGGCAGTAGCCTCTACAGCGCCAGGTCTTCGGATATATCTCGTAAAAGCAGTCAAGCATCAGTTGTATCGGGAGCAGTGGCGGGAGGAGTCGGGGCGCAACGTCTAGTCGCGCACCACACCGCGGCGTACGACCAGCTCTCTCCCGACAGCAGTCGAAGATCTAGTCAAGTTTCGTGTGCGGGATACGCACCTCCGCCCTCATCAGCCCTGGCCGCTGTGCAGGCCGTCAGGACATCGCAAGGGAATCAGGCCATCCTACTCCGGGGAGTCACATGTTCTGAAGTCAGGGCAGAGGAACTAGCATTGGAGTTGGATCCGAACGTTCAAGTGAAAGAAGAGGCGAGAAGACTTTCGGAGCAGTCGAACTTAAGTGATCAGACCCAAGGCTACCAGCCGTACCCTTGCGGAACCGACGGTTTGGGCGACGCTCCGTTCCCGTTCAAAACTGAATGCGACCAGGAAACTGTGACGTATAAGGAGTCACGGTCCAATTCCACCAGCACCGTGGTGGTCACCACGGCACAGATCCACCACCCCAACCAGGAAGTCAACTTGGAACAGGTGGCTGAAGGTGAAATGGTGGAGAATAAGCTGGTGATACCCGACGAAATGATGCAATATCTTAACCAATCAATATTGGCAACCGAAGCGGAAACATCAGCTAAAACGGACTCCGCAAATCGACCTAACACAGAACCGAGTCTAGATAAGGACAGTGCTACCAAAGACAATACCACAAACGAACAACAAAACACTAATAATTCCAGTGATAAAGTCAGTGACGTAGCGACCAGTGACGATTCTCTACTTAAAAATCTAGGTGCCATAGGAAGTGATCTCAATATAAGTGATATTCAAGTCGATTTAAGGTCGTTAGACGTTAGTATGTCGGGCAACAGCGGCTCTCTTCTGGCTGTCAAAACACCCGAAGATAAAACTCCTCTACAAGAACAAGTCACCCCGGAAGTCAAAGCAGAGAACAAAGAAAGGGAAACGAAGAAGTCGGATCCGAATCCTTTGCAATCACTGCAAACGATGACAGCCAACCAGACTGAACAATCCAATAAAATTAGGGCTAATGCTCAGAAACAGAATAAGACGAATACTAAGACTATAATGAGTCAAAATATTTTGAGTCCGCAGAACCTGCCTCACAGCATGTTGAGTCCACAAAGCCTCCCGCACAGTGCAATGAGTCCACAAAGCGTTATGAGTCCGCACAATATCCCACAAAATATTATGTCCCCTCCCAGTGCTTATAACGTGATGAGCCCCCAAAGTGCGATGAGTGTAATGTCCCCGCAGCATAATGCCATGAGCCCACAAAGCATGCAAAGTCTCATGAGTCCACAGATACCCAACCAAATAATGTTGAGCCCTCGTCACAATAACGTCAGTAGCCCCATGTCACAGAATATGGCTAGTCCCATGATGAACATGGCTAGTCCGATGGGACAGACCATAGCCAGTCCCATGAGCCACGGTATGCCCAGCCCCATGCATCCAGGAATGCAAAGCCCAATGGGACAGGGCATGGCAAGTCCAATGATACAAAACATGCCGGTGGCTATGAACGGACCTGTGAACCCCAATCTCCAAAATCAAATGATCAACGTTAATCAACAACAAATGGCTCTCAACTATCGGCCCAACTGTCACAGAATGCCGGCTCGGCCAAATATGCCGATGCCGAACCAGTACACGCAAAATTACAATAACAACCAACCACCACAATATCCAATGCAAAACCAAAATGTTAACGTGCACCATCAAAACGTGCAAAATTATCAAATCATGCAATCTTACAACCAGAACCAAGCACCGACGGTCAATCAAATGGTTCAAAATCAGAACGTTCATTATCCGAACCAGCCTATGATGAACTACCAACAGATGAACTTCAACCAGAACAGCCGTGCTCACCCGATGCAGTCGTCTAGATCGTCCATGATGAGCGTCGACAACAGCGGCAATATGACCCGGGGTGTAATGACCAGTTACTGCGACACGCAACACCAGTGCCCGCCCGCACAGACCAACCATTACAACCAGAACGTACAGTACCCTCAGCCGCCTCCATACAATGCCGTCGTCAATAACAACGTGATGGGACCTCCACCACCGAAGAACAATCACCAATACAACCAAGCTATGATGAACAATAACCAATATTACAATCACCAGAGGCCTTACAACCAATGGGACTATCCAGGCAATCAGTTCAACAAACACAATCCACAGAAGTCCACACCGAATTCCGTGAACATGTCGACGGGAAGCCAGAAACAAGTCAAGTGCAACCGGCTGACGAACTGCAACCAAATCAAGAACGACCAGGCTGATTGCAGCATGAACAGCCTGAGGAGCCAAAACAATCAGCCCAGCGAAGTCCAAGTCTGGGACATATCTCAGTCGCAAATCGAAGCGAACAACGGAAGACGGAAGACCCAAAACAATTCAATGAGACAGGAAACTTATCAGAGAACGCTGGAGTACGTCGAGAACTGTGAAAACTGGAAGAGTTCTGAAATGGTGTCGAGCACCACGCATCCCCTGCAAGGCGATAATATGGTTGTGAATGACCTCCAGACGTCTTTGTCTTCGTTTTACGAGGAGAATCAATACCTCCAAATGATTCAATAG
Protein
MTAAVLCPVVWVDCKLEFPTQDDLVKHINTDHIHASKKAFVCRWVGCSRDEKPFKAQYMLVVHMRRHTGEKPHKCTFEGCCKAYSRLENLKTHLRSHTGEKPYTCEYPGCAKAFSNASDRAKHQNRTHSNEKPYVCKAPGCTKRYTDPSSLRKHVKTVHGAEFYASKKHKGCTRGDDSAESGGGGAGSSPRSEEGGVPPAIRGHTSSASVKSESPASPIPHGLHTSAHQLSAQCGGELDFGGGLGGYRDENGLPYFRLDGEIEQEVVGEVGQLPLMLRAMVAIGEPRAAPHAPRLGNKMALARMPPPHADLGGGGVTGRTELGSTNVGVELKTGASNTRRDSGISSGSSLYSARSSDISRKSSQASVVSGAVAGGVGAQRLVAHHTAAYDQLSPDSSRRSSQVSCAGYAPPPSSALAAVQAVRTSQGNQAILLRGVTCSEVRAEELALELDPNVQVKEEARRLSEQSNLSDQTQGYQPYPCGTDGLGDAPFPFKTECDQETVTYKESRSNSTSTVVVTTAQIHHPNQEVNLEQVAEGEMVENKLVIPDEMMQYLNQSILATEAETSAKTDSANRPNTEPSLDKDSATKDNTTNEQQNTNNSSDKVSDVATSDDSLLKNLGAIGSDLNISDIQVDLRSLDVSMSGNSGSLLAVKTPEDKTPLQEQVTPEVKAENKERETKKSDPNPLQSLQTMTANQTEQSNKIRANAQKQNKTNTKTIMSQNILSPQNLPHSMLSPQSLPHSAMSPQSVMSPHNIPQNIMSPPSAYNVMSPQSAMSVMSPQHNAMSPQSMQSLMSPQIPNQIMLSPRHNNVSSPMSQNMASPMMNMASPMGQTIASPMSHGMPSPMHPGMQSPMGQGMASPMIQNMPVAMNGPVNPNLQNQMINVNQQQMALNYRPNCHRMPARPNMPMPNQYTQNYNNNQPPQYPMQNQNVNVHHQNVQNYQIMQSYNQNQAPTVNQMVQNQNVHYPNQPMMNYQQMNFNQNSRAHPMQSSRSSMMSVDNSGNMTRGVMTSYCDTQHQCPPAQTNHYNQNVQYPQPPPYNAVVNNNVMGPPPPKNNHQYNQAMMNNNQYYNHQRPYNQWDYPGNQFNKHNPQKSTPNSVNMSTGSQKQVKCNRLTNCNQIKNDQADCSMNSLRSQNNQPSEVQVWDISQSQIEANNGRRKTQNNSMRQETYQRTLEYVENCENWKSSEMVSSTTHPLQGDNMVVNDLQTSLSSFYEENQYLQMIQ

Summary

Pfam
PF00096   zf-C2H2
Interpro
IPR036236   Znf_C2H2_sf        + More
IPR013087   Znf_C2H2_type       
SUPFAM
SSF57667   SSF57667       
PDB
2GLI     E-value=1.16756e-68,     Score=665

Ontologies

Topology

Length:
1226
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00019
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  1226
 
 

Population Genetic Test Statistics

Pi
26.626765
Theta
26.981158
Tajima's D
-0.766001
CLR
0
CSRT
0.182840857957102
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号