SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16496
Annotation
S08404_hypothetical_protein_1_-_silkworm_transposon_mag
Location in the cell
Nuclear   Reliability : 2.696
 

Sequence

CDS
ATGGGTGAGGAAGCGTACGATTTATTATCGACATTAGCCAGCCCTTCGAAGCCGTCACAATTAACATATGCTAATGCTGTAGCGATGTTGGCAGCTCACCTGCAACCGAAGCCCTCAATCTTGGCGGAAAGATACAAGTTTCGACAACGTCGGCAGCTGAATGAGTCAATAGCTGACTACCTCACAGAATTAAAAAAAATATCAAAAAATTGTGAATTCGGCTCGTCGCTGGATGAAAATCTGCGTGATCAAATGGTTTGTGGATTAAAGAGCGAAATCATACGGCAAAGGTTATTTGCCGAGGAGAAATTAGAATATAAGCGTGCAGTTACGTTAGCTTTGTCATTAGAAGCTGCGGAGAGGGATGCGATTGCAGTGGAACGTACGCCAATTGAGGAGGTTAACAAAATTAACTTCAATGAATGTTCAAGATGTGGAGACAGGAGACACCAAGCAAAGGATTGCATATACAAAGACTACGTGTGCAGTTCATGTCATGAAACCGGCCATCTACGAAGAATGTGCCCCAAAAACGGGCTTAAGAACCAGGCGGAGGCAGCCGGGGGTTCAGCACGCACCGGGCGCCGGGGAACCGGGGTGCAGGCGGCAACAGGCGATCGTGGCGCGGGCAGCGCGGTGCGGGACGAGGAGGCCGAGAGCGGGCTCCTTTGCACTTATTATACGATCAAAACAACGATGACACATACAACAACTTCAATAATGAACAGGACGGGTGTGGAGAAGAAAATGAGCCTATGTACCAAATGA
Protein
MGEEAYDLLSTLASPSKPSQLTYANAVAMLAAHLQPKPSILAERYKFRQRRQLNESIADYLTELKKISKNCEFGSSLDENLRDQMVCGLKSEIIRQRLFAEEKLEYKRAVTLALSLEAAERDAIAVERTPIEEVNKINFNECSRCGDRRHQAKDCIYKDYVCSSCHETGHLRRMCPKNGLKNQAEAAGGSARTGRRGTGVQAATGDRGAGSAVRDEEAESGLLCTYYTIKTTMTHTTTSIMNRTGVEKKMSLCTK

Summary

Similarity
Belongs to the complex I LYR family.
EMBL
RSAL01000130    RVE46453.1    JTDY01002326    KOB71659.1    LSMT01000298    PFX20931.1    + More
LSMT01000050    PFX30415.1    GGMR01013781    MBY26400.1    GEZM01051399    JAV74971.1    HADZ01011823    HAEA01016148    SBP75764.1    NCKU01014527    RWR99571.1    GEDC01021971    JAS15327.1    GEDC01013717    JAS23581.1    AGCU01195578    GEZM01030100    JAV85807.1    GFAC01001043    JAT98145.1    HAEB01010230    SBQ56757.1    LSMT01000091    PFX28043.1    LSMT01000354    PFX19571.1    GEGO01007419    JAR87985.1    NWSH01000218    PCG78288.1    GACK01000385    JAA64649.1    GEFM01006397    JAP69399.1    GEDC01023506    GEDC01023205    JAS13792.1    JAS14093.1    GEDC01007675    GEDC01003661    JAS29623.1    JAS33637.1    GBYX01426815    JAO54450.1    HAEJ01014645    SBS55102.1    AZHX01001899    ETW98899.1    GEBQ01003960    JAT36017.1    JTDY01003118    KOB70119.1    GEBQ01006635    GEBQ01000281    JAT33342.1    JAT39696.1    JTDY01006045    KOB66341.1    ABLF02019752    LSMT01000102    PFX27500.1    GACK01003652    JAA61382.1    LSMT01000299    PFX20902.1    ABLF02015736    ABLF02039528    ABLF02042142    ODYU01000701    SOQ35910.1    KL367545    KFD65042.1    GGMR01020219    MBY32838.1    GEBQ01022644    GEBQ01012433    JAT17333.1    JAT27544.1    GEBQ01030602    JAT09375.1    MRZV01000292    PIK53317.1    JTDY01015222    KOB51965.1    GFWV01017841    MAA42569.1    GFJQ02007084    JAV99885.1    KL363363    KFD46575.1    LSMT01000001    PFX35006.1    RJVU01027767    ROL48908.1    GGLE01005288    MBY09414.1    JTDY01012655    KOB52243.1    JTDY01004038    KOB68679.1    KV463122    OCA13964.1    NIRI01002335    RJW62347.1    JTDY01001749    KOB72999.1    GEZM01043158    JAV79264.1    RQTK01000238    RUS83602.1    GEHC01000976    JAV46669.1    GEHC01000975    JAV46670.1    EF199621    ABM90392.1    KL367711    KFD59948.1    AZHX01001887    ETW98968.1    GEDV01006828    JAP81729.1    LSMT01001234    PFX12679.1    KL367556    KFD64442.1   
Pfam
PF00078   RVT_1        + More
PF17919   RT_RNaseH_2
PF17921   Integrase_H2C2
PF00665   rve
PF05347   Complex1_LYR
PF00098   zf-CCHC
PF03732   Retrotrans_gag
PF17917   RT_RNaseH
PF00929   RNase_T
PF12796   Ank_2
PF03564   DUF1759
PF00077   RVP
Interpro
IPR001584   Integrase_cat-core        + More
IPR041577   RT_RNaseH_2       
IPR012337   RNaseH-like_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR000477   RT_dom       
IPR036875   Znf_CCHC_sf       
IPR008011   Complex1_LYR       
IPR005162   Retrotrans_gag_dom       
IPR001995   Peptidase_A2_cat       
IPR041373   RT_RNaseH       
IPR002110   Ankyrin_rpt       
IPR013520   Exonuclease_RNaseT/DNA_pol3       
IPR020683   Ankyrin_rpt-contain_dom       
IPR036770   Ankyrin_rpt-contain_sf       
IPR001969   Aspartic_peptidase_AS       
IPR005312   DUF1759       
IPR018061   Retropepsins       
IPR034128   K02A2.6-like       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
SSF48403   SSF48403       
Gene 3D

Ontologies

Topology

Length:
255
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.14068
Exp number, first 60 AAs:
0.13925
Total prob of N-in:
0.01657
outside
1  -  255
 
 

Population Genetic Test Statistics

Pi
4.625542
Theta
5.122729
Tajima's D
0.234399
CLR
0.585278
CSRT
0.464076796160192
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号