SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16495
Annotation
S08405_hypothetical_protein_2_-_silkworm_transposon_mag
Location in the cell
Mitochondrial   Reliability : 1.878
 

Sequence

CDS
ATGTTAGACTTACATAAATCCTTGTTCGACGGCACATTGGGTAAATATACGGGGGGCACAGCAGAGTTAATCGTGCGGCCGGATGCGGTGCCTATCTACTGCCGCGCGCGACCGCTGCCGTATGCGCTGCGCGAGCGCGTCGATGCCGAGCTCGACGCGATGCTGGCCGCCGGCGTCATCAAACCGGTGGACCACTCCGACTGGGCCACGCCACTTGTCGTAGTACGCAAAGCGGACGGCGGTCTGAGAATATGTGCGGACTATAAGGTAACCCTTAACAAAGTATTAGCAATCGACAGATTTCCGGTTCCAAAAATGGAGGACTTATTCAGTAATCTCAGCGGAAATAAATTTTTTACTAAGCTTGATTTATCTCAAGCTTATAATCAAATAGTCTTATCAGAACGTTCTAGCGAGTACACGGTTATCAATACACATAGAGGATTATTTAAATATTCCCGCCTCGTCTACGGGTTAGCTTCGAGCCCAGGCATTTTTCAAAAACTAATGGTAAATATGTTTAAAAATGTCCCAAATGTAGTAGTTTTCTATGATGACATATTGATTAGAAATCAGGACCTAGACAGTCATTTAAAGTCTATAAAAGAAGTATTAGATATATTAGAAAGGTATGGCTTAAAAATTAAAAGGAGTAAGTGCGAGTTCATGGTAACAGAAGTGAGGTATTTAGGGTTCATAATAGATCAAAATGGGGTTCGTGTAGACCCAGAGAAAGTCAAATCAATAGCAACAATGCCACACCCAAATAACGTGACAGAATTAAAATCTTTCATCGGTATGGTAAACTTCTATTCGAAGTTCATACAAGATTTGAGTGCACATTTATCACCTTTATATGCCCTTTTAAAAAAAGGTAAGCACTGGATGTGGGGAAATGAACAGAATGCTGCTTTCCTGAATGTTAAAAAGTTTTTGTGTAGTACAAAAGCACTCGCACATTTTGATATGTCTTTGGAGTCGGTGTTGACTGTGGATGCGAGCGCGCGTGGTCTGGGTGCCGTGTTGGCGCAGCGCGGGCCAGGATGTCAGGAGCGCGTCGTTGCATACGCTTCACGCGCACTCACCACTCATGAATTACACTACAGTCAGATTCATAAGGAAGCATTGGCGATTGTTTTCGCGGTGGAAAAATTCCATCAATACTTATATGGGAGAAAGTTCATACTACGGACCGACCACAAACCTCTGGTGAGCATTTTCGGGCCTAACATAGGTATCCCGAGCGCGGCAGCTAGCCGCTTGCAGCGCTGGGCTATTAAACTATCAGCATATGACTTTGAAATCGAGTACGTTAGGACAGATAAAAATGTAGCCGATGCACTTTCACGGTTAATCGAGTCTCAAAAAAATGACGTAGCTTCCGAGGAAACAGACTTACCCGAGCAAACCTACTTACACTTCTCAACAGAAGCTCTGTTAATAGATTATAATGTTCTTAAAAAACAAACTAGTAGTGATCCAATCTTAAGTCGCGTATTAAGTTATTTAAGGGACGGATGGCCCTTAGACATAGAAATTAATGAATTAAAACCATATTATAATAGGAAAAACGAACTTTATATTGAATTAGGATGTATAATGTGGGGTCATCGTGTGGTTATACCCTCTTCATGCAGAAACAAAATAATAACGGAGCTTCATGATCCGCATATGGGCATAGTGAAAACAAAATCGCTAGCACGTAGTTACGTTTGGTGGCCGGGAATCGACGAAGCGCTCGAGACGGAATGTCGCGCTTGCACCGTGTGTGCTGCCGTCGCAGACGCACCTTCTACACACGCGCCCCGCTCGTGGCCCTGGCCCTCACGCCCCTGGTCCAGGTTACACTTAGACTTCTTAGGCCCCATAGGTGGAGTCACTTACCTAGTTGTAGTGGATTCATGCTCCAAATGGATAGAGGCAATTAAAATGCAGAGGACAACGGCACAAGCGGTTATATCGGTACTGCGGGACTTGTGGTCAAAATTCGGCCTGCCAAAGCAAACGGTCAGTGACAATGGACCGCCTTTCTCGAGCTCTGATTTTCAGAAGTTTCTGATTCATAATGGCATAAAACATATTTATTCAGCTCCCTATCATCCCGCCTCTAATGGGGCCGCTGAAAATGCAGTTAAAATTTGTAAACGTGCGATTAAAAAGGCATTAAAACAGAATTTAAACGTAGATACAGCTCTGTGTAGATTTTTATTAGCCTACAGAAATACAGAACATGCAACTACCGGCGATAGTCCAGCCAATATATTACAGGGTCGAAGTCTCCGTATGAGATTAGATAATTTAAAACCAGAAAGGCAATCTCGAGTTATCGCGCAACAAGAGCGGAGCGAGCAAAACGCAGGGGGTGTGCAGCGACAACTCGAGCCGGGCACTAAGGTGTGGTATCGGGATTATCGAGGTCTGGATAAATGGGTACCTGGGACGATCCTCAAGCAATTAGGTAGTCGTGATTACTGTGTACGATCTAGTTTTGGAACCGAGAATCATAGGCACGTCGATCAGCTAAAATTAAGGGTTACAAAAAATATAGATAAAGTTGATACCTTTGCGTCGATTCGTAAAAATATAAGTCCCGAACTGATCGCGCAAAATTTAGACTTAAGAACACAATCACGTAAGTCGCTATCATTTCCCATGACAAGTGGCGAGGAACCAGTGGCGGTGGTCAACGATTCGGGGAAGAGTAGTTCACCACCAAAAAATAGCACACCGGCACAGGATGCTGTATCGCCTATTCGTGGCAGCCCTATGAGACCCGCTGTGCCGATAGACAAGGGAGCATGTAATACTGGTGGTAAGAGTATCAATGAAAATGTGACACCCAAACGTGAACGTCCTGTAAGAATACGCAAGCCACCAGTTAGATATGGATTCGAGGAAATAGATTAA
Protein
MLDLHKSLFDGTLGKYTGGTAELIVRPDAVPIYCRARPLPYALRERVDAELDAMLAAGVIKPVDHSDWATPLVVVRKADGGLRICADYKVTLNKVLAIDRFPVPKMEDLFSNLSGNKFFTKLDLSQAYNQIVLSERSSEYTVINTHRGLFKYSRLVYGLASSPGIFQKLMVNMFKNVPNVVVFYDDILIRNQDLDSHLKSIKEVLDILERYGLKIKRSKCEFMVTEVRYLGFIIDQNGVRVDPEKVKSIATMPHPNNVTELKSFIGMVNFYSKFIQDLSAHLSPLYALLKKGKHWMWGNEQNAAFLNVKKFLCSTKALAHFDMSLESVLTVDASARGLGAVLAQRGPGCQERVVAYASRALTTHELHYSQIHKEALAIVFAVEKFHQYLYGRKFILRTDHKPLVSIFGPNIGIPSAAASRLQRWAIKLSAYDFEIEYVRTDKNVADALSRLIESQKNDVASEETDLPEQTYLHFSTEALLIDYNVLKKQTSSDPILSRVLSYLRDGWPLDIEINELKPYYNRKNELYIELGCIMWGHRVVIPSSCRNKIITELHDPHMGIVKTKSLARSYVWWPGIDEALETECRACTVCAAVADAPSTHAPRSWPWPSRPWSRLHLDFLGPIGGVTYLVVVDSCSKWIEAIKMQRTTAQAVISVLRDLWSKFGLPKQTVSDNGPPFSSSDFQKFLIHNGIKHIYSAPYHPASNGAAENAVKICKRAIKKALKQNLNVDTALCRFLLAYRNTEHATTGDSPANILQGRSLRMRLDNLKPERQSRVIAQQERSEQNAGGVQRQLEPGTKVWYRDYRGLDKWVPGTILKQLGSRDYCVRSSFGTENHRHVDQLKLRVTKNIDKVDTFASIRKNISPELIAQNLDLRTQSRKSLSFPMTSGEEPVAVVNDSGKSSSPPKNSTPAQDAVSPIRGSPMRPAVPIDKGACNTGGKSINENVTPKRERPVRIRKPPVRYGFEEID

Summary

Similarity
Belongs to the alpha-carbonic anhydrase family.
EMBL
RSAL01000130    RVE46453.1    GECU01037588    JAS70118.1    GEFM01006397    JAP69399.1    + More
GCES01042893    JAR43430.1    GCES01151725    JAQ34597.1    GEZM01001427    JAV97782.1    GEDC01007675    GEDC01003661    JAS29623.1    JAS33637.1    GCES01009650    JAR76673.1    GEZM01092768    GEZM01092767    JAV56467.1    AB126055    BAD86655.1    GEDC01023506    GEDC01023205    JAS13792.1    JAS14093.1    GGMR01020219    MBY32838.1    AZHX01001899    ETW98900.1    UYSL01002587    VDL65922.1    GEZM01030100    JAV85808.1    HADX01010638    SBP32870.1    HADW01008367    SBP09767.1    HAAD01006009    CDG72241.1    EF199621    ABM90392.1    NIVC01001652    PAA65446.1    EF199622    ABM90393.1    GDHC01002706    JAQ15923.1    GDHC01001627    JAQ17002.1    GBHO01027669    GBHO01027668    JAG15935.1    JAG15936.1    HAEH01013823    SBR98409.1    GEZM01050895    JAV75318.1    GEZM01085308    JAV60010.1    NIVC01000264    PAA86792.1    GEZM01050896    JAV75317.1    NIVC01000551    PAA81070.1    NIVC01001308    PAA69606.1    AAGJ04079710    JYDO01000093    KRZ71620.1    GFWV01013596    MAA38325.1    GEZM01009754    JAV94336.1    GEZM01009753    JAV94337.1    GEGO01002226    JAR93178.1    JYDP01000327    KRZ01162.1    MRZV01000143    PIK57404.1    GFXV01004590    MBW16395.1    GGMR01003713    MBY16332.1    GBIH01000761    JAC93949.1    GL379857    EGT56876.1    DS268431    EFO96847.1    JARK01001350    EYC24344.1    GEZM01014356    JAV92133.1    GL379789    EGT45549.1    GBHO01033645    GBHO01033640    JAG09959.1    JAG09964.1    GEGO01004800    JAR90604.1    GBHO01042583    JAG01021.1    GGMR01010825    MBY23444.1    GDHC01007869    JAQ10760.1    GBHO01027659    JAG15945.1    GEFM01002211    JAP73585.1    PDUG01000024    PIC12319.1    GEHC01000992    JAV46653.1    DS268526    EFO85571.1    AAZX01023237    JARK01001341    EYC29776.1    JARK01001424    EYC04378.1    EYC04377.1    PDUG01000003    PIC40683.1    PIC40685.1    PDUG01000002    PIC45869.1    PDUG01000006    PIC22136.1    NIVC01000860    PAA75827.1    JARK01001405    EYC07744.1    DS268438    EFO99392.1    RSAL01000066    RVE49348.1    JYDO01000377    KRZ65389.1    PIC21513.1    PIC39813.1    PIC40866.1    BN000789    CAJ00230.1    EYC07745.1    JARK01001647    EYB84723.1    EYC07746.1   
Pfam
PF00078   RVT_1        + More
PF17919   RT_RNaseH_2
PF17921   Integrase_H2C2
PF00665   rve
PF00098   zf-CCHC
PF00077   RVP
PF17917   RT_RNaseH
PF03732   Retrotrans_gag
PF00481   PP2C
PF00194   Carb_anhydrase
Interpro
IPR001584   Integrase_cat-core        + More
IPR041577   RT_RNaseH_2       
IPR012337   RNaseH-like_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR000477   RT_dom       
IPR036875   Znf_CCHC_sf       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR018061   Retropepsins       
IPR041373   RT_RNaseH       
IPR034128   K02A2.6-like       
IPR005162   Retrotrans_gag_dom       
IPR036457   PPM-type_dom_sf       
IPR001932   PPM-type_phosphatase_dom       
IPR018338   Carbonic_anhydrase_a-class_CS       
IPR001148   CA_dom       
IPR036398   CA_dom_sf       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
SSF81606   SSF81606       
SSF51069   SSF51069       
PDB
4OL8     E-value=2.19409e-58,     Score=575

Ontologies

Topology

Length:
968
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01699
Exp number, first 60 AAs:
0.00024
Total prob of N-in:
0.00045
outside
1  -  968
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.022078
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号