SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16132
Pre Gene Modal
BGIBMGA004530
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.353 PlasmaMembrane   Reliability : 1.746
 

Sequence

CDS
ATGAAGTCAGTGTCGGAACGTTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTAGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGTCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGACGCCTTCAGCTCTAACACTAGGAGCAGGCTTAGGGACCTCGGTCCGAGAAGTTGGGGCCTCGCCGCAAGGCGAGTGTTTTCAAGACCCGGGGCCGCCCCACCTGGGTACTCAGCGATCATGGACGCTGTATTCGCGGAATTCCTCCGACTTCGCCACCCACAGCACGCCTCGGAGTTTTTGGCCTTCAAGGCCAATCACACTGCGAGCCCTCTCGAGGACTCCGCCGCGCTCGCTGCTCCTGCGTCGCCTGTACCTGCGTGCAGAGCTTCTGCATTGAGCACCGCAGCCTCTGTCGTGCCTGCCGCTCCCGTGTCGCCTATACTGGCGAGAAAAGCTGCTGCGTCGTCCGCCGTGACCATCGTTTCAGCTGAGCGATCATCCGCGGCCTCCGTCGCGCCCTCTAAAACACCTACACTTGCTCGTAGGTCGCCTGCACCCGCCTCCTCGTGCTCCGACTCTGACTCGGACATGGAGGTCGACCTCGCCCCCGCCTCATCGACGGATGGATTCACCCTGGTACAGAAGGGTAAGAAGCGTGCCGCGGAGTCTCGAGCTCCCGCGGCCGCTAAAATTAGCAAAGCCGTGAACGCGTCGCGCCCCCGCCCTCAGACTCCCGTTGCGCCCCCAGCCCGTGCCACTCCGTCGCCGCGTCCGGTGGCACAAAATAAAACCCAGACCCCTCCCCCGGTTATCCTTCAGGAGAAGGCAGCTTGGGATCGAGTTTGCCTGGCCCTTAAGGCCAAAAATATAAATTTCACGAATGCCCGTAACCTCGCGAACGGCATTCAAATTAAGGTTCAAACACCCGACGACCATAGGGCCCTCTCTTCTTACCTCCGTAAGGAGCGTATAAGTTTCCATACGTATACGCTCCAGGAGGAGCGCGAACTCCGCGTTGTAATACGCGGAATCCCTAAAGAGTTAGATGTAGAGCTCGTAAAAGCCGACCTGTTAGAACAAGGCCTACCAGTGAATTCTGTGCACCGTATGCACACCGGTCGCGGTAGGGAGCCATATAATATGGTTCTAGTCGCTCTCCAGCCTACCCCCGAGGGTAAGAAAATCTTTAACACACAGACCGTCTGTAGGCTCTCTGGTATCGCTGTCGAAGCCCCCCATAAAAAAGGCACTCCTAGCCAGTGCCATAACTGTCAATTGTACGGGCACTCTTCCCGTAACTGTCACGCGCGCCCCCGATGTGTTAAGTGTTTGGGCGATCACGCCACGGCCCTCTGCGCTCGCGACCAAAAAACCGCGACGGAACCGCCTAGCTGCGTCCTGTGTCGAACACAGGGTCACCCCGCGAATTACCGTGGTTGCCCCCGAGCCCCTAAAATAAATCGCCGCGTCGCCCGCCAAAACCGCCTCCGAGCTTCCGGCCCAGACATCAAAGCCTCGGCACCCTCTGCGTCGCAGGCTAAGCCAGCGTTCGTTCCGGCGGCGGTGCCCAGTGTCTCGGCCTGGGCAAAACCGCTGCCGTACACGAACACGGCTACAACTCCCTCCTCCGCGATTCGTCCCGCCCCCGCGACTCGTCCCTCTCCCGCGACTTGCCCTCCGACCGCGTCCGACAATCTCGCTTTAGCGATCGACTTCTTTCAGTCGATCGACTTTGAGCGCGTTAACGCTTTGGGCGACGCCATTCGCGCTGCCTCCACTGCACAACACTTTATCGCCGTTGTGCAAGAATACGCCGACGAGACCCTACTTAAGCCCGCGCGCCGTGACCCTAAAATCGCGAACTATAACATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGTATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCATACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTTCCGTTTAGTCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCGTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAGCAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGCCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATCCGTGCGTACGATAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCACCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCTCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCATGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTTATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCCAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAATCCATACCCTGGGTCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCCTCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGGATTTGGTCATAACCAAAATGAGGGCGATAGCGTTCACACCTTAATAGAAAAATGTGCCAAGAATAAACTTGCTTATACGCCATATGAGACAGGTATCCCTGATAACCACTACAGCATGGCGTCGATAAACAGCTGCGGGGAATTGAAGAGTCCCGGGGACCCAGAGAAAAAGATCCCGGATACCGACGCTGAGAAACAACCGCTTTCCGGGGAAAAAGAAGAAAAATTGTGGACCACATTGATGCAGGTAGCTGTACCCTTCTTTATAGCTGGCTGCGGTACCATCGGAGCTGGTTTGGTGCTCGGCAAAGTTAGGGATTGGGATGTTTTTATAAACATATCGGCCATTTTCGTTCTTGTGCCCTCACTGTCAGGACTAAAGGGTAACCTGGACATGTGTCTCGCATCTCGACTGTCAACGCAGGCGAATTTGGGCAACATGGACTCCACGAAGGAGGTCATCTCGATGGTCGTTGGAAACATATCATTGGTTCAGGTTCAAGCTATAGTGGCTGCGACTGTGGTCTCCATATTCGCCATCGTGGTGAACACGATCACGGACCGCGCCATCTTCGGGCCCTATGTCCTCCTGCTGGTCGCGTGCGCCGTCTTCACTGCTACCACCACTTGCTTTGTGTTGGATTTCGTGATGGTAATGGTGATATACGCGTCGCACAGGTTCAAGGTGAACCCGGACAACGTGGCGACTCCGCTGGCGGCCTCCATCGGAGACATCGTCAGCAACACTGTGCTAGCCGTCACCGCCCAGTACATGTACGAGCAGATCCAGGTGTCTCTGTGGCAGCCCATCGCGTTGATCTGCGTGTACTACAGCCTCCTCCCGCTGTGGGTGTTCATCGTTTGGAGGAACAAGTACACCAAGACCGTCCTCACCAGCGGCTGGACCCCCGTCATCTCCGCCCTGTTCATAAGCGGTATCGGCGGTATAGTCCTGGACCAGGCCGTCGATTACTTCCGAGGGTACGAAGTGTTCCAGCCGATCGTGAACGGGATCGGGGGGAACCTGGTGTGCGTACAGTCGTCCCGGCTGGCCACGCACCTCCACCAGACCGCCATCCCCGGGATCCTGCCGGAGAACACTAAGATCATTGAGTGGCCTTGGAAGACCTTGTTCTTTGGAACGACCGCGGCGAAGGTGGCTCGCATGCTGCTGATCCTGGCCGTCTTCGGGCAGATAATCTTCATGGTGGTCGCGGACTTCGTGTACCAGGGGACGGTCACCATCCAGTTCGCGTTCGGCATCACGTACCTCACGTGCGCCCTGCTGCAGGTGATGCTGCTCCTTTACCTGGCCTACATCGTGATCCACTTCATGTGGAAGAGGAAGAAGGACCCCGACAATGCCGCCATCCCCTACCTCACGGCGCTCGGAGACCTCCTCGGCTCCGTGTTCCTGGGACTCGCCTTCGTCATCCTGTCCCTCTTCGGACTGGAATACGGCAATAATGTCCAGTGA
Protein
MKSVSERYFDKAMRHDNRLIVAAADYSPNPDHAGVSHRRRPRHVLTDPSDPITFALDAFSSNTRSRLRDLGPRSWGLAARRVFSRPGAAPPGYSAIMDAVFAEFLRLRHPQHASEFLAFKANHTASPLEDSAALAAPASPVPACRASALSTAASVVPAAPVSPILARKAAASSAVTIVSAERSSAASVAPSKTPTLARRSPAPASSCSDSDSDMEVDLAPASSTDGFTLVQKGKKRAAESRAPAAAKISKAVNASRPRPQTPVAPPARATPSPRPVAQNKTQTPPPVILQEKAAWDRVCLALKAKNINFTNARNLANGIQIKVQTPDDHRALSSYLRKERISFHTYTLQEERELRVVIRGIPKELDVELVKADLLEQGLPVNSVHRMHTGRGREPYNMVLVALQPTPEGKKIFNTQTVCRLSGIAVEAPHKKGTPSQCHNCQLYGHSSRNCHARPRCVKCLGDHATALCARDQKTATEPPSCVLCRTQGHPANYRGCPRAPKINRRVARQNRLRASGPDIKASAPSASQAKPAFVPAAVPSVSAWAKPLPYTNTATTPSSAIRPAPATRPSPATCPPTASDNLALAIDFFQSIDFERVNALGDAIRAASTAQHFIAVVQEYADETLLKPARRDPKIANYNMVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFSPDSIPSPQDTAEAIDIVTSHITSTLDRSSKQVVAEDFLHRFKLPDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRITEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCMPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAAPALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQSIPWVRKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPGFGHNQNEGDSVHTLIEKCAKNKLAYTPYETGIPDNHYSMASINSCGELKSPGDPEKKIPDTDAEKQPLSGEKEEKLWTTLMQVAVPFFIAGCGTIGAGLVLGKVRDWDVFINISAIFVLVPSLSGLKGNLDMCLASRLSTQANLGNMDSTKEVISMVVGNISLVQVQAIVAATVVSIFAIVVNTITDRAIFGPYVLLLVACAVFTATTTCFVLDFVMVMVIYASHRFKVNPDNVATPLAASIGDIVSNTVLAVTAQYMYEQIQVSLWQPIALICVYYSLLPLWVFIVWRNKYTKTVLTSGWTPVISALFISGIGGIVLDQAVDYFRGYEVFQPIVNGIGGNLVCVQSSRLATHLHQTAIPGILPENTKIIEWPWKTLFFGTTAAKVARMLLILAVFGQIIFMVVADFVYQGTVTIQFAFGITYLTCALLQVMLLLYLAYIVIHFMWKRKKDPDNAAIPYLTALGDLLGSVFLGLAFVILSLFGLEYGNNVQ

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
2016
Number of predicted TMHs:
9
Exp number of AAs in TMHs:
213.53568
Exp number, first 60 AAs:
0.00017
Total prob of N-in:
0.00085
outside
1  -  1604
TMhelix
1605  -  1627
inside
1628  -  1633
TMhelix
1634  -  1651
outside
1652  -  1685
TMhelix
1686  -  1708
inside
1709  -  1720
TMhelix
1721  -  1743
outside
1744  -  1790
TMhelix
1791  -  1813
inside
1814  -  1819
TMhelix
1820  -  1842
outside
1843  -  1910
TMhelix
1911  -  1933
inside
1934  -  1944
TMhelix
1945  -  1967
outside
1968  -  1986
TMhelix
1987  -  2009
inside
2010  -  2016
 
 

Population Genetic Test Statistics

Pi
234.595682
Theta
162.100184
Tajima's D
1.385322
CLR
0.266039
CSRT
0.756562171891405
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号