SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16044  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA004558
Annotation
PREDICTED:_lysine-specific_demethylase_lid_isoform_X2_[Bombyx_mori]
Full name
Lysine-specific demethylase lid       + More
Lysine-specific demethylase 5A      
Alternative Name
Histone demethylase lid
Jumonji/ARID domain-containing protein lid
Protein little imaginal disks
Retinoblastoma-binding protein 2 homolog
Histone demethylase JARID1A
Jumonji/ARID domain-containing protein 1A
Retinoblastoma-binding protein 2
Transcription factor
Location in the cell
Nuclear   Reliability : 3.348
 

Sequence

CDS
ATGGGAAAATGTGACGAAGCTAATGTCGAAGTTAGCATGGGGGACTCAGCGTCCCCCATGAAACCTGATAACTTTACGTTTACTCCACCTCCAGAGGCTCCTGTCTTTGAGCCTACACCAGAAGAGTTTTTGGACCCTTTAGCGTACATCAGTAAAATACGTCCTATCGCCGAGAAATCGGGCATTTGCAAGATAAAACCACCAGCGCACTGGCAACCCCCATTCGCAGTTGATGTGGACCGACTACGGTTTACACCGCGAATACAACGGTTAAATGAGCTCGAGGCAATAACGAGGGTGAAGCTTAACTTCTTAGACCAGATTATAAAGTTTTGGGAACTGCAAGGGTCAACGTTCAAGATTCCGACTGTCGAAAGGAAACCGCTCGATCTCTATTCGTTGCATAAGATTGTGAAAGAAGCCGGTGGCTTCGAAATATGTTCAGCAGAGAGGAAATGGTCGAAGATAGCCCGCCGCATGGGCTACCCGCAAGGCAAAGGCGTCGGTTCAATATTGAAGAATCACTACGAACGCATCCTGTATCCTTATGACGTGTTCAAGAACAATGGAGCAGTCGGAGACAATAAGGAGACAAAAATCGAAGTCAAATCAGAACAGACCCCCGAGAAGGCAACGGCGACACGCAGTCGTTCAACGACCAAATGTCCCCCCGGGGCCGCGGCCACCCCGCCTCCCGCCCGTCGGTACAAGTCCGAGCCCGAGCCGGCAGCTGAAGGTAGTCACACCGAAGGCGCCCTCGTCGGATCTGAAGATTCGATTATGAAAACTCCCATTAAAGAGGAGAACCCCGAAATAAGACGGACAAGTCCTCGTGAGAACAAATGGATGTCGGCGGGAGCCAGTTGCGGTTCGCGAGCGCGCGTGACCCGCTCCACCCGTCTCCGCGAGCATCGCGTCAACAACATGACGGTCTCCGTGACGCCTGCCCCGCCCGCACCCAACACGCATCCCGATGATCCGTTGGCGAAGTATATGTGTCACGTGTGCGGCCGGGGCGACGTCGAGGAGCAGATGCTGCTGTGCGACGGCTGCGACGACTCGTACCACACGTTCTGTCTCGTGCCGCCGCTCGCGGACGTGCCCAAGGGCGACTGGAGGTGTCCAGTGTGCTTAGCCGAAGAGGTATCGAAGCCGACTGAAGCTTTTGGTTTCGAGCAGGCCACCCGCGAGTACACGCTGCAACAGTTCGGCGAGATGGCGGATCAGTTTAAATCAGATTACTTCAACATGCCCGTGCACATGGTTCCAACGTCGACTGTGGAAAAGGAATTTTGGCGCATCGTATCGTCGATAGACGAAGACGTCACGGTCGAGTACGGAGCGGACCTTCACTCGATGGACCACGGCTCGGGGTTCCCGACCAAGTCCAGCGCTCACCTGTACCCTGGGGAGCAGCAGTACGCAGACTCCAGCTGGAACTTGAACAATCTACCGGTTCTGGAGGGTTCCGTGCTGGGACATATCAACGCTGATATATCAGGAATGAAGATACCTTGGCTGTACGTGGGCATGTGCTTCGCAACGTTCTGTTGGCACAACGAGGACCACTGGAGCTACTCCATCAATTATTTACATTGGGGAGAACCTAAGACATGGTACGGAGTGCCAAGTTCAAAGGCCGAGCAATTTGAAGCCGCAATGAAGGCGGAAGCTCCAGAGCTGTTCCAGCTGCAACCGGACCTGCTGCACCAGCTTGTCACGATCATGAACCCTAATGTGCTGATGAAAGCTGGTGTTCCCGTTTACAGAATGGATCAGCACGCTGGAGAATTCGTGATTACGTTTCCTCGCGCTTATCATGCCGGCTTCAACCAAGGCTATAATTTTGCCGAAGCGGTCAACTTTACACCAGCTGATTGGTTGAAAGTGGGCCGCGAATGCATCGCGCACTACTCCACGTTGCGGCGCTACTGCGTGTTCTCGCACGACGAGCTGGTCTGCAAGATGGCGCTGGAGGCCGACTCGCTCAGCCTCAGCGTCGCGCTGGCCGCCTACCGGGACATGCGCACCATGCTGCACGACGAACGGAAACTCCGGAAGGGACTGCTGGATTGGGGTGTAACGGAAGCGGAACGCGAGGCCTTCGAGCTGCTACCAGACGATGAGCGGCAATGTCACATGTGCAAGACGACGTGCTTTCTGTCGTGCGTGACGTGTCGCTGCACGCCCGCCGTCGCCTGCCTGCGACACTACGTCGAGCTGTGCAACTGCAGCCCGCAGGCGCACAGGCTCAGATACCGTTACACCTTAGATGAATTGCCAGCGATGCTGGAGAAACTAAAGAAGAAATCGGAACAGTTCAGGGAGTGGGCTGAAGCTGTGCAGAATGCTCTAGATCCAGATACGCCTAAGACTTGTGATTTAGACGGACTGAGGGCGCATTTGAAGAAAGCTCACGAACTTAAGATTCACAAGACCGAGCTAGTTCGTGCTTTAGAAACGGCTATAGAAGACGCCGAAAAGTGTGCTTCGGTAATACAGCAACTGGACTTGAACAAGATGCGGACTCGAACCCGACACCACGACCCCAAATACAGGCTGACCATACACGAGCTCACTTTGTTCGCGGCAGAAATTGACGGCCTCGCTTGTGTTTTGCCCGAAGGCTCGGCTGTCAAAGAAGTCTTACGTCAAACGTCAGAGTTTGAGTCGAAAGCATCGGAATTGATCAACAAAGACCTGGACAAGATTGAACCTGGCTACGTTAGGGAATTAGAAGAGGTTGTAGATTTAGGATCTCGGCTCTGTATAGTGCTGCCGCAGCTGGCGCCCCTGCAGGCGCGGCTCCAGCAAGTGAAGTTTGTCGATGAAGTGCAGCAATACAGGGACGAGTGCTCCACCCTCACTCCGGAGGTCATCGACCGGCTGTTGCAAGATGCCGAAAAACTTGTACCTCATCGCAGGGTTGAACTGGAGAGGGCTGGACTATACAAGTTGAAAGCCCTAGTAGAAGAATGGGAGGAACGCGCCCGAGCTGTCCTCATAGATACAACAAAGTCGAAAGATTCGTCGGAAGCGGACGAGCCGCAGTACACGACCCTGGCCGAGCTGAGTCTGCTGCTCGCCGACGGTGATGAGATCGAGGCGGCCCTGCCCTCGTACCACGCGCTGCAGACCGCCGTGGCTCACGCAAAGGACTGGCTGGCCAAGGTTGAAGAGATGCAATCCAAAGATCTGTACCCGTACATGCACAGCGTGGAGTCTGTTGTGCGCCGCGGGCAACAGATCCCGCTGGCGCTGTACGAGAAAGATCAGTTGGCGGCCGCCCTACAGTCTGCCAAGGAATGGAAACGTGGTGCGGCCGAAATGTTTCTAAAAAAGAATTGGCCATATTCGTTACTGGAAGCCCTGTCGCCAAGGACTGAAGGAGCCGAGAGCTTATCAACAGCGCGGCGCCGGGCGCGAGCCGCCGTCGGAACCGAACCGCCTCCCTCGACGTTAGAGGCCGGCCTATTCCTGAGGAACTTCAGCGAAGACTCCACCCCCACAGAAATCGTAGCGGCGTTCAAACAAGCGGAGATTACTGAACTCAATTCAATAAAAACTTTAAGAGCCCGTAACATGAGGAAGGAAGTCCGGGCCCCACCCGCGGCAGGCGTCACGTTTTGCGTCTGCCAGAAACGGCAATATGGTGTCATGACCCAGTGTGAGCTGTGCAAGGATTGGTTCCATGCTTCATGCATATCATCGATGAAGGACGAGCGGGAGGAGTCGCCGGACCGCGGGGAGGGCGCTCCGTTTTCGGGAGCCGAAAGTAAATTTCTGTGCCCGGACTGTATGAGGACCAAACGGCCCAGGCTGGACCGGATCTTGGGGCTACTGGTGTGGCTGCAGAAGCTGCCGGTCCGGCTGGCGGAGGGCGAGGCGCTGCAGTGCGTGACGGAGCGCGCCATGTCGTGGCAGGACAGCGCGCGGGCGCTGCTGGCCGCCCTGCCGCACCGCGCTGACATGACGAACAGAGAAAAGGCAGATAAACTGAATGCTGAGTTAAAGAAGGCAACAGGAAGAGCTCATGATCTCCATAATGCGCATAATCCAAGGTCGTCGGCCAGCGTGGAGCACGCGTACAGCGCCACGCCGCGGTCGCCCAGCGCGAGGATGGCGCCCGGCATGCTGCACAAGCTGGAGGAACTCATGCTCGAAGGCGACCTCTTGGAGGTGCGGCTAGAGGAGCAGGCGCAGGTGTGGTCGGCGGTGTGGTGCGCGCGCGCCGCCGACGGACGCAAGGCCACGCGCGTGCTCGACGCCGGCCGGCGGAAGCGGCAGCGGCAGCAGCGACACCACCACCAGCTCAAGAGGACCAGGACCAGGCATCACCACGGACCTACAACAACGAAAACATCAATCAAACGCGGCTCGGCCACGACGACTAATTATCTCAACAGAAAGCAGGGCGTGTCGTCGGGCTCGAGTCTGATGATGAGGAAACATTACATGGCGCGGCAGGAAAGACGTAAACGCGGCCTCGCCGCTGCCCGGGGGAAGCATTCGTCAAGGGGAGATGGCGCGTCCCACAGTACCGGAAGCCGGGCAATCGCGGCGAGTCGACGGAGCAGCTCATCCTCGATGTCCTCCGCCGATGATGACGAAGATTGCGCCGCTTCTAATTGTCTAAGGCCTACTGGTAAAGTGGATTGGGTGCAGTGCGACGGTGGGTGCGACCAGTGGTTCCACATGCACTGCGTCGGGCTCAGCCGCGGCGCGCTGCGCGACGACGACGACTACGTGTGCGGCACGTGCGCCGACGCGCGCTAG
Protein
MGKCDEANVEVSMGDSASPMKPDNFTFTPPPEAPVFEPTPEEFLDPLAYISKIRPIAEKSGICKIKPPAHWQPPFAVDVDRLRFTPRIQRLNELEAITRVKLNFLDQIIKFWELQGSTFKIPTVERKPLDLYSLHKIVKEAGGFEICSAERKWSKIARRMGYPQGKGVGSILKNHYERILYPYDVFKNNGAVGDNKETKIEVKSEQTPEKATATRSRSTTKCPPGAAATPPPARRYKSEPEPAAEGSHTEGALVGSEDSIMKTPIKEENPEIRRTSPRENKWMSAGASCGSRARVTRSTRLREHRVNNMTVSVTPAPPAPNTHPDDPLAKYMCHVCGRGDVEEQMLLCDGCDDSYHTFCLVPPLADVPKGDWRCPVCLAEEVSKPTEAFGFEQATREYTLQQFGEMADQFKSDYFNMPVHMVPTSTVEKEFWRIVSSIDEDVTVEYGADLHSMDHGSGFPTKSSAHLYPGEQQYADSSWNLNNLPVLEGSVLGHINADISGMKIPWLYVGMCFATFCWHNEDHWSYSINYLHWGEPKTWYGVPSSKAEQFEAAMKAEAPELFQLQPDLLHQLVTIMNPNVLMKAGVPVYRMDQHAGEFVITFPRAYHAGFNQGYNFAEAVNFTPADWLKVGRECIAHYSTLRRYCVFSHDELVCKMALEADSLSLSVALAAYRDMRTMLHDERKLRKGLLDWGVTEAEREAFELLPDDERQCHMCKTTCFLSCVTCRCTPAVACLRHYVELCNCSPQAHRLRYRYTLDELPAMLEKLKKKSEQFREWAEAVQNALDPDTPKTCDLDGLRAHLKKAHELKIHKTELVRALETAIEDAEKCASVIQQLDLNKMRTRTRHHDPKYRLTIHELTLFAAEIDGLACVLPEGSAVKEVLRQTSEFESKASELINKDLDKIEPGYVRELEEVVDLGSRLCIVLPQLAPLQARLQQVKFVDEVQQYRDECSTLTPEVIDRLLQDAEKLVPHRRVELERAGLYKLKALVEEWEERARAVLIDTTKSKDSSEADEPQYTTLAELSLLLADGDEIEAALPSYHALQTAVAHAKDWLAKVEEMQSKDLYPYMHSVESVVRRGQQIPLALYEKDQLAAALQSAKEWKRGAAEMFLKKNWPYSLLEALSPRTEGAESLSTARRRARAAVGTEPPPSTLEAGLFLRNFSEDSTPTEIVAAFKQAEITELNSIKTLRARNMRKEVRAPPAAGVTFCVCQKRQYGVMTQCELCKDWFHASCISSMKDEREESPDRGEGAPFSGAESKFLCPDCMRTKRPRLDRILGLLVWLQKLPVRLAEGEALQCVTERAMSWQDSARALLAALPHRADMTNREKADKLNAELKKATGRAHDLHNAHNPRSSASVEHAYSATPRSPSARMAPGMLHKLEELMLEGDLLEVRLEEQAQVWSAVWCARAADGRKATRVLDAGRRKRQRQQRHHHQLKRTRTRHHHGPTTTKTSIKRGSATTTNYLNRKQGVSSGSSLMMRKHYMARQERRKRGLAAARGKHSSRGDGASHSTGSRAIAASRRSSSSSMSSADDDEDCAASNCLRPTGKVDWVQCDGGCDQWFHMHCVGLSRGALRDDDDYVCGTCADAR

Summary

Description
Histone demethylase that specifically demethylates 'Lys-4' of histone H3, thereby playing a central role in histone code. Does not demethylate histone H3 'Lys-9', H3 'Lys-27', H3 'Lys-36', H3 'Lys-79' or H4 'Lys-20'. Specifically demethylates trimethylated H3 'Lys-4'. Required for the correct regulation of homeotic genes during development. Plays a role in the regulation of the circadian rhythm and in maintaining the normal periodicity of the circadian clock. Regulates the expression of clock-controlled genes including tim, per and cry.
Histone demethylase that specifically demethylates 'Lys-4' of histone H3, thereby playing a central role in histone code. Does not demethylate histone H3 'Lys-9', H3 'Lys-27', H3 'Lys-36', H3 'Lys-79' or H4 'Lys-20'. Demethylates trimethylated and dimethylated but not monomethylated H3 'Lys-4'. Regulates specific gene transcription through DNA-binding on 5'-CCGCCC-3' motif (PubMed:18270511). May stimulate transcription mediated by nuclear receptors. Involved in transcriptional regulation of Hox proteins during cell differentiation (PubMed:19430464). May participate in transcriptional repression of cytokines such as CXCL12. Plays a role in the regulation of the circadian rhythm and in maintaining the normal periodicity of the circadian clock. In a histone demethylase-independent manner, acts as a coactivator of the CLOCK-ARNTL/BMAL1-mediated transcriptional activation of PER1/2 and other clock-controlled genes and increases histone acetylation at PER1/2 promoters by inhibiting the activity of HDAC1 (By similarity). Seems to act as a transcriptional corepressor for some genes such as MT1F and to favor the proliferation of cancer cells (PubMed:27427228).
Cofactor
Fe(2+)
Biophysicochemical Properties
9 uM for 2-oxoglutarate
2.9 uM for histone H3K4me3
Subunit
Interacts with Myc. Part of a complex containing Lid, Myc and Ash2.
Interacts with SUZ12; the interaction is direct (By similarity). Interacts with the viral protein-binding domain of RB1. Interacts with ESR1, MYC, MYCN and LMO2. Interacts with HDAC1 (By similarity). Interacts with ARNTL/BMAL1 and CLOCK. Interacts (via PHD-type 1 zinc finger) with histone H3 unmodified at 'Lys-4' and (via PHD-type 3 zinc finger) with histone H3 di- and trimethylated at 'Lys-4' (PubMed:19430464).
Similarity
Belongs to the JARID1 histone demethylase family.
Keywords
3D-structure   Biological rhythms   Chromatin regulator   Coiled coil   Complete proteome   Developmental protein   Dioxygenase   Iron   Metal-binding   Nucleus   Oxidoreductase   Phosphoprotein   Reference proteome   Repeat   Transcription   Transcription regulation   Zinc   Zinc-finger   Activator   Alternative splicing   Isopeptide bond   Polymorphism   Ubl conjugation  
Feature
chain  Lysine-specific demethylase lid
splice variant  In isoform 2.
sequence variant  In dbSNP:rs11062385.
EC Number
1.14.11.-
EMBL
BABH01025736    ODYU01007122    SOQ49616.1    KQ458671    KPJ05553.1    NWSH01000704    + More
PCG74680.1    PCG74681.1    AGBW02009205    OWR51383.1    GBYB01012792    JAG82559.1    KQ982543    KYQ55365.1    NEVH01015827    PNF26510.1    KQ414889    KOC59831.1    KQ435794    KOX73732.1    APGK01047273    KB741077    ENN74310.1    KK852908    KDR13965.1    KQ971307    EFA11272.1    KQ434778    KZC04317.1    GEZM01063974    JAV68883.1    UFQT01000213    SSX21795.1    GANO01000303    JAB59568.1    GEZM01063973    JAV68884.1    JXJN01004961    CCAG010020379    GAKP01006510    JAC52442.1    GDHF01028322    GDHF01026578    GDHF01020500    GDHF01019764    GDHF01011066    GDHF01009763    JAI23992.1    JAI25736.1    JAI31814.1    JAI32550.1    JAI41248.1    JAI42551.1    GBXI01001916    JAD12376.1    GAMC01006258    GAMC01006257    JAC00299.1    KA648850    AFP63479.1    AFFK01019071    GDRN01040654    JAI67145.1    GEDC01023261    JAS14037.1    GEDC01014538    JAS22760.1    CP012523    ALC38767.1    GEDV01008313    JAP80244.1    GFPF01008411    MAA19557.1    CH940649    EDW63540.2    GFPF01008413    MAA19559.1    CH902620    EDV31945.1    OUUW01000010    SPP86086.1    CH954177    EDV57934.1    KQS70204.1    CH379058    EDY69617.1    KRT03332.1    GFPF01008412    MAA19558.1    CH933807    EDW12161.1    KRG03111.1    AE014134    AFH03582.1    AFH03583.1    AFH03584.1    AHN54164.1    AY095051    CM000157    EDW88860.1    KRJ98060.1    KRJ98061.1    SPP86085.1    CH480820    EDW54444.1    CM002910    KMY88429.1    KMY88430.1    KMY88431.1    CH479180    EDW28237.1    LJIG01001222    KRT85718.1    CH963857    EDW76339.1    AHZZ02001506    AHZZ02001507    JSUE03005893    JSUE03005894    JSUE03005895    GAQG01000004    JAB84503.1    AQIA01009614    AQIA01009615    AQIA01009616    AQIA01009617    AQIA01009618    AC239182    AQIB01143904    AQIB01143905    AQIB01143906    AADN05000523    CM001286    EHH65978.1    JU476643    CM001263    AFH33447.1    EHH20373.1    AWGT02000049    OXB80445.1    AJWK01032971    AAPE02024379    AAPE02024380    AAPE02024381    ADFV01077957    ADFV01077958    ADFV01077959    ADFV01077960    GABE01000739    JAA44000.1    AKHW03002956    KYO36588.1    AABR07061907    AABR07061908    AABR07061909    AABR07061910    NDHI03003614    PNJ15429.1    ABGA01223271    ABGA01223272    ABGA01223273    ABGA01223274    ABGA01244473    ABGA01244474    ABGA01244475    ABGA01244476    ABGA01244477    ABGA01244478    S66431    AB209999    AC005844    AC007406    BC048307    BC053893    BC110916    PNJ15433.1   
Pfam
PF08429   PLU-1        + More
PF00628   PHD
PF01388   ARID
PF02375   JmjN
PF02373   JmjC
PF02928   zf-C5HC2
PF04387   PTPLA
PF04969   CS
Interpro
IPR003349   JmjN        + More
IPR019786   Zinc_finger_PHD-type_CS       
IPR013637   Lys_sp_deMease-like_dom       
IPR001606   ARID_dom       
IPR019787   Znf_PHD-finger       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR036431   ARID_dom_sf       
IPR011011   Znf_FYVE_PHD       
IPR003347   JmjC_dom       
IPR004198   Znf_C5HC2       
IPR018247   EF_Hand_1_Ca_BS       
IPR007052   CS_dom       
IPR008978   HSP20-like_chaperone       
IPR007482   Tyr_Pase-like_PTPLA       
SUPFAM
SSF57903   SSF57903        + More
SSF46774   SSF46774       
SSF49764   SSF49764       
Gene 3D
PDB
5V9T     E-value=0,     Score=2308

Ontologies

Topology

Subcellular location
Nucleus  
Nucleolus   Occupies promoters of genes involved in RNA metabolism and mitochondrial function.   With evidence from 18 publications.
Length:
1591
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00016
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  1591
 
 

Population Genetic Test Statistics

Pi
303.555168
Theta
189.656856
Tajima's D
2.120642
CLR
0.238918
CSRT
0.897455127243638
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号