SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15296  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA005048
Annotation
PREDICTED:_dynein_beta_chain?_ciliary-like_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 2.399
 

Sequence

CDS
ATGGGAACAATAGAGTTTTGGAAGAAATCTCCATGGAAGAAGATAGATGCAGATGGTATGGATCAGGAATGCAAGCGTTTCACAAAAGATTTGCGACAGTTGGACAAGGAAATGAGGGTTTGGGAACCATACCTGGTAATTGAGGGGATAATAAAGAATTTGCTGACATCACTACGAGCCGTCACCGATTTACAGAACCCAGCTATAAAAGACAGACATTGGATCGAACTGATGATGGCGACAAAGAAATCACTTCATTTAAACCTCATGACTATCAACTCACACCCATCATCACCATCAACTTCATCACTAGAAAGAAATGTTATTTTCGAGGAAGTATTAGAAGATTTTAAATCTATAGAAGAGTGCGCAAAAGGCATAGAAATTCATACATTATACAAAGAGGTTAAGTTCCACATCGATGATGATACCACGTTAGCTGATCTGTTAGCTCTTAGTCTACATAAATATGAAGAGGAGGTAAAAACTATTGTCGATAAGTCTGTTAAGGAGGCAGCCATGGAAAAAACGCTTAGAGAATTGGAGGCAACATGGGCTATCATGGAATTCGATTATACCACGCATGACAGAACTGGTACAAAATTACCGAAAGCTAGCGAAGAATTGGTGGAGACATTAGAAGACAACCAGAACCAAGTGCAAAATATGATGTCCTCAAAGTTCATTGGTTTTTACGAAACGGAGGTAACAGTTTGGCAAAAGAAATTAGGAACCGCTGATGCTGTGATCGCCTTATGGTTCGAGGTACAAAGGAAATGGCAGTATTTGGAAAGCATCTTTGTCGGTTCTGATGATATTCGATCACAGTTACCGGAAGATTCCAAGAGATTTGATGGAATTGATAAGACATTTAAGGAATTACTAAAAGATATTGGAGTCACTCCAAACGTTGTGCAAGCTACGAATAAGCCCGGACTTCTGGACAAACTTGAAGACCTAATGAAGGCTCTCAATCTTTGCGAAAAGGCACTTAACGATTACTTGGAAACAAAACGATTGGCTTATCCAAGATTTTATTTTGTGTCTTCTGCAGATTTGTTGGATATCTTATCAAACGGCAACAATCCACCTGCAGTATGCCGCCATCTTACCAAGTTGTATGATAATTTAGCAAAACTGGTGTTTCCGAAACCGGGTAGTAAGCAAGCGTATGAGATGATATCCAAAGAGAACGAAGAACATGTGCCATTTAAAGCACCATGCTGTGATTGTTCTGGAAAGGTGGAGCTTTGGTTAAACCGAGTGACAGATTGCATGCGTTATACTTTGCGCGATATTTTCGAGCATTGTGTGAAATCGTATGAGGATAAATCACGAGACGAGTGGGTGTTCGACTGGCCGGCCCAGCCAGCGCTGGTTGGCACACAGATCTGGTGGACCACGGAGACAAACCAGGCGTTTGCAAAATTGGAAGAAGGTTATGAAAACGCACTTAAAGATTATCAAAAAAAACAGATCGCCCAACTGAACGCATTAATTGTTCTACTTCTTAGCGATCTGACTGTGGGAGATCGTCAGAAAATCATGACTATTTGTACCATAGACGTGCATTCACGAGACGTTGTAGCTAAACTCATAGTTGCCAAGGTGGAAACTTCAAATGCGTTCCAATGGCAAAGTCAGTTAAGGCATCGCTGGGACAGCAACTTAAATAATTGTTTCGCTAATATTTGCGATGCTCAATTTCTATACGACTACGAATATTTAGGGAACACACCTAGATTAGTCATCACACCTCTAACTGATAGATGCTACATTACTTTGACACAGAGTCTTCATTTGATAATGGGCGGTGCACCAGCAGGTCCAGCTGGTACTGGTAAAACTGAAACCACCAAAGATTTGGGCAGAGCTCTAGGAATTATGGTATACGTGTTCAATTGTTCAGAGCAAATGGATTATAAATCTTGTGGAAATATTTACAAAGGCTTGGCCCAAACTGGTGCTTGGGGATGTTTCGATGAGTTCAATAGAATATCGGTGGAAGTTTTGTCAGTAGTGTCAGTCCAAGTGAAGAGTGTACTAGATGCAATTAAAGCCAAGAAGAAAAAGTTTGACTTTATGGGAGAGTACATAACGCTCATATCCACTGTGGGAATGTTTATTACTATGAATCCAGGGTATGCGGGAAGAACGGAACTGCCAGAGAATTTGAAGGCTCTGTTTAGACCCTGTGCCATGGTGGTACCGGATTTTGAACTGATTTGTGAGATCATGTTGGTTGCCGAAGGATTTCAAGAAGCTCGTTTACTGGCGCGCAAGTTTATTACCTTGTATATGCTGTGCCGAGAGTTGTTATCTAAACAAGATCACTATGATTGGGGTTTGAGAGCCATCAAATCTGTACTGGTGGTTGCTGGATCTTTAAAGCGTAGTGATCGTCAGCGTCCAGAAGATCAAGTGTTGATGAGAGCTTTAAGAGACTTCAACATCCCGAAGATTGTAACAGATGACACACCTGTGTTTATGGGACTCATTGGAGATCTTTTCCCGGCATTAGATGTACCGAGAAAAAGAGACATGGACTTTGAGAAAAGTTTGATTGAGGGAGCACTTTCGATGAAGCTGCAGCCTGAACCTGGCTTTATTCTAAAAATGGTACAGTTAGTGGAATTATTTGCCGTTCGTCACTCAGTATTCATCATAGGATTTGCTGGAACTGGCAAATCAATGGTGTGGCAATGTTTGTACAAGACATATTACTTGTTAAAACAGAAACCATTTTACAATGATTTGGATCCGAAAGCTGTAACTAATGATGAGTTGTTCGGTGTTATTAATCAAGCTACGCGAGAATGGAAGGATGGCTTATTTTCGACGATCATGAGGGATATGGCAAACATGCCTGGGGATGGACCAAAATGGATCGTGTTGGACGGTGATATTGACCCAATGTGGATTGAATCCTTGAACACTTTAATGGACGACAATAAAGTGTTAACTTTGGCCAGCAATGAACGAATCGCATTAACGAAATCAATGAGGCTGTTGTTTGAAATATCTAATTTGCGTACCGCGACACCGGCGACGGTATCGCGAGCCGGTATTTTGTACATCAACCCTCAGGATCTAGGTTGGAATCCTTTCGTAGCCTCATGGATAGATACGACTCGTGACGATGAATCAGAGAAAGCAATGTTGACTATAATGTTTGATAAGTACATACCGTCTTTACTGGAATCGTGCAAGAAGTACAAGCGTATCACTCCATTAACGGATTTGCAGCAGATTCAGCTGACATGCTATTTGTTGGAGTGCTTTCTGAACAAATCATTGTTACCCAGCGACTGTCCCAAGGAATGGTATGAGACATACTTTGCGTTTTCCGTTGTATGGGGCTTTGGGTCTGGTCTGTTCCAAGATCAACTCGTAGATTGGCGCAATGAGTTCAGCAAATGGTTTTGTAACGAATTTAAGCAAATTAAATTCCCTTCAACCGGCAATGTGTTCAGTTTCTTTATCGATCCGGAGACAAAGAAATTTCTCCCGTGGTCGGAGAAAGTGGAGTCATTTGAGCTCGATCCCGATTTACCGTTGCAGTCATGCTTAGTATCAACTTCGGAGACCACCCGTATAAGGTTCTTTATGGATCTGCTACTGGCCAAACAAAAGCCGGTGATGCTAGTAGGTAGCGCCGGTAGTGGCAAAACTGTTAGTGTTGCTGCTAAACTTAATTCATTACCGGAATCGTACGCGATCACAAATGTACCTTTCAACTTTTATACGACATCTGAAATGATGCAGAAAGTTCTAGAAAAGCCATTAGAAAAGAAGTCTGGACGAAATTTTGGCCCGCCGGGAAGCAAGTTCATGATTTATTTCGTTGATGATCTTAACATGCCTGAAGTTGATACATATGGTACTGTTCAACCGCACACACTTATCCGAGAGTTTATGGATTACAAACATTGGTACGACCGCCAAAAGTTATCATTAAAAGAAATATCTAACTGTATGTTCGTTGCGTGCATGAATCCAACAGCCGGCTCCTTTACCATTGATCCTCGTTTACAGAGACACTTCTGCACATTTGCCGTCAGTTTTCCCGGTATCGATGCGTGCTTCCATATTTACAAACAAATCCTATCTCAGCATGTAAACAACCCGTTGAATAAGTTTGGTCCTTTAGTGCAGCGTTATGCTGAGCCTCTCGTGAACGCAGCGCTTACACTCCACAACAAATTGGCTTCGGCATTTTTGCCAACAGCAATTAAATTTCATTACATATTTAATTTGAGAGACCTATCAAATATATTCCAGGGCATGCTTTTTACAACCGGAGACGCGATAAAAACGCAATCAGATTTGATCAGACTATGGATGCATGAAGCAACGCGTGTTTATTCCGATAAAATGGTCGAGGAAGCTGACAATGAAGCTTTCCAGAAGCTCATCAGTGAAGTTATCAAGAAAAATTGCGAGGATTACGATGAAAATGTAGTATTCGAGAAACCTTTAATCTACTGTCATTTTGCTGAGGGGGTGGGTGACCCAAAATATTTTCCTATCAGAGACTGGCCTCAAGTAAAAAAGCTGTTGGACGAATCTTTGTCTTCTTATAATGACCTCGTGGCCACTATGAACCTCGTTCTATTTGAAGATGCAATGTATCATATTTGCAGAATAAATCGAATATTAGAGGCACCCCGAGGTAATGCCCTGTTGGTCGGCGTCGGAGGATCAGGAAAACAGTCGTTATCCAGACTGTCTGCATTTATATCCTCATTAGAAGTTTTCCAGATACAATTGCGAAAAGGATACAGTATTAACGATTTAAAAGTAGATTTAGCGACCCTCTATATTAAATCCGGTTTGAAGAATTTAGGAAATGTGTTTTTAATGACGGACGCTCAGGTAGCCGATGAAAGATTCCTCGTACTGATCAACGACTTGTTGGCTTCTGGTGAAATACCAGAGTTGCTTGCTGATGATGAAATTGAAAATATTATAAACGGAGTCAGAGGAGAGACAAAAGCTTCGGGTGTCCCGGATACTCGAGAGAATTGCTGGAGATTTTTCATCAATCGAGTAAGAACGATGCTAAAAGTCGTACTATGCTTTTCACCAGTAGGTGCAACATTACGTATCCGAGCTCGAAAGTTCCCATCCATTGTCAATTGCACAGCTATTAACTGGTTCCATGAGTGGCCACGTGAGGCTTTACGGTCTGTGTCGAAACGGTTTATATCTGAAGTGGAATCGTTACCGCCAGATTTAGTAGATCCTGTATCTAATTTTATGTCGCACGTTCATCAAAGCGTGAATCAAATGTCAGCCGTTTATTTCCAAAACGAGCGACGTTACAACTACACCACACCTAAAACGTTCCTCGAACAAATATCACTTTACACGAAGTTGTTAAATGAAAAGACAACAAACTTGAAGATGATGATCGCTAGATTGGAAAACGGCTTGGAGAAGTTGGCTTCCTGTGCTGCGGATGTAGCCGTTTTGAAGGTCACATTAGCTGAACAAGAAATAATTTTAAAAGAAAAGAACAGGGCCGCTGAAGCACTTATCGAAGTTGTTGGAGCTGAAAGTGAAAAAGTGTCCAAAGAAAAGGCATTTGCTGCTGAAGAAGAGAAGAAAGTGAAAGTGATAGAAGAAGACGTTACAATAAAAGCTAAAATCTGCGCTGACGATTTAGCAAAAGCTGAGCCTGCTTTACTCGCAGCACAAGAAGCCTTAAACACCTTAAACAAAAATAACTTAACCGAGCTAAAGTCTTTCGGCTCACCTCCAGACGCCGTAGTTAACGTAACGGCAGCTGTCCTCGTACTCTTTTCTAAGAAAGGGAAGATCCCCAAAGACAGGTCATGGAAATCTTGTAAGAGTATAATGGCAAAAGTCGATCAGTTTTTGAATGATCTGGTTTTCTATGACAAGGAGAATATACATCCTGACGTTATAAAGGCGGTTATGCCTTACATCAAGAACCCGGAGTTTAACGCTGAATTCATAATGTCAAAGTCGGCTGCAGCAGCTGGTCTGTGTGCTTGGGTGATTAATATAGTGAAATTCTACGACGTGTACGTTGTCGTCGAACCCAAGCGTCGAGCTTTGAACCAGGCTAATGCCGAACTTCAAGCGGCAAGAGATAAACTTGCCTTCTTGACTGATCAGATCAAGGAATTGGAAGAGAAATTAGAGGTATTATTAAAAGCCTTCCAAGAAGCGGTCAACGAAAAGATGAAGTGTCAAGCCGAAGCTGACGCCACTAATGCGACAATCGATTTGGCAAACAGACTTGTGAATGGTCTCGCTTCGGAAAAAATAAGATGGTCGGCAACGGTGGTGAACCTGAAGGAATCTGGTGTTATGTTACCTGGAGATGTTTTGTTGATAACGGCTTTCATATCTTACGTGGGGTGTTTCATGCGAGGCTACCGACAACAGCTAATGTACGAGGATTGGATACCAACTCTGCAGAAAACAAACCCCAAAATCGAAACCACCGAAGGACTGGATCCACTGTCAATGTTGACCGATGACGCTCAAGTGGCTTGCTGGAATAACGAGGGTTTGCCTACTGACTCCATGAGCACCGAAAATGCTACTATTTTGACAAATTCGGCACGTTGGCCATTAATGATTGATCCGCAGCTTCAAGGTATAAAGTGGATTAAATCAAGATATGGCGACTCTTTAGTAGTGATAAGACTGACGCAACGAAATTATTTGGATCGTATCGAACGTGCTGTGACTAACGGAAACGTGGTTCTGCTGGAGAACATTGGAGAAACTGTGGATGCTGTGCTTGAGCCTCTGCTAGGACGTGTGCTCATACGCAAAGGGAAAGTTTTAAAGATTGGTGATAGAGAAATAGATTACCATCCAAACTTCCGTCTGGTAATACAGACGAAATTGGCCAATCCACATTACCAACCAGAGATGCAAGCACAATGTACACTCATAAATTTCACAGTCACAAGAGACGGGTTAGAAGAACAACTGCTGGGTGAAGTAGTGAAAGCTGAAAGACCTGATCTCGAGAGTCTTCGTGCCGGTCTCACTAAGCAACAAAACGATTTTAAGATTACGCTTAAAACTCTAGAAGACGATCTTTTGAAGCGTTTGTCTTCCGCCGGCCCTGATATCCTTAGCGATTCAGCGCTGGTTATTAATTTGGAGATCACGAAGAAAACTGCCGCCGATATAGAAATAAAAGTCGAAGAAGGAAAAATTACGGCAGTCAAAATAGATGAGGCTCGAGAACGTTACAGACGAGCTGCAAACCGCGCTTCCCTCCTCTACTTCATATTGAACGAGATCTACAAGATCAACCCTATGTATCAGTTCTCCCTAAAGGCGTATAGCGTTGTGTTCAGAGATGCCTTGGCCCGGGCCGAGCCGGCTGACGATCTTGAAGGCCGAGTACGAAACTTGTTGGACAGTATAACGTTCTCGGTGTTCGTCTATACCAGCAGAGGGCTTTTTGAACGCGACAAGCTGGTGTTCTTGTTTTTAATCACGCTACAGGTTTTACAAGGAGAAGGTAAAATAGATCCAAGAGAATTAGACTTTTTACTAAAATACGCGGTCGCTCCCGAAGTGTCTCCATATTCGTGGCTCTCGAATAATTCCTGGGGCGGGATCGTTGCCTTATCAAAAATGGACGCCTTCGAAAATCTCGATAAAGACATTGAAGGTGCTACTAAAAGATGGCAAAAGTACACTGACGGAGAGGCACCAGAAAGAGATAAACTTCCTGGTGAATGGAAGAACAAAACCTCTTTACAGCGTTTGTGTATCATGAGAGCGTTGCGACCTGACCGCATGTCATACGCCTCAAGTGCGTTTTGTGAAGAGAATTTGGGCACGAAGTATGTGGAAGCTCGGACGCCTCCGATTGAAAAGTCATACCAAGAAAGTAATTCCACTACGGCTATGTTCTTTATATTGTCGGCCGGAGTGGATCCGCTCAAGGATCTCGAAAAATTAGGCCGTAAATTAGGGTTTTCGACAGACAAGAAGAACTTCCACATCGTTTCACTTGGTCAAGGTCAGGAGATAGTGGCCGAGGAAGCTATGGGTGTGGCTTCGGCTAACGGACATTGGGTCATCCTGCAGAACATACACTTGGTAGCGAAATGGCTAGCTACTTTAGAAAAGAAGATGGAAGAAACATTTGAAAATCCTTTACCAGAATACAGACTCTATTTGAGCGCAGAGCCTGCAGCTGATCCGGCTTACCATATTATACCTCAAGGTATCTTAGAGTCTGCAATCAAAATTACTAATGAGCCTCCAATCGGTATGTGGGCTAATTTGCACAAGTCTCTAGATAATTTCAATCAGGAAACTCTTGAGATGTGCAGCAAAGAGGCCGAGTTCAAGTCAGTTTTGTTTGCGCTTTGCTATTTCCACGCTGTCGTTGCTGAAAGACGGAAATTTGGGCCGCAAGGTTGGAACAGGGTATATCCATTCAATTTTGGCGATTTAACAATCTGCGTTTACGTGCTCTATAACTATTTGGAGGCTAATCCTCGGGTTCCTTGGGAAGACTTGAGGTATCTATTCGGAGAGATCATGTACGGCGGTCACATTACAGATGATTGGGACAGGAGACTCTGCAGAACATTCCTCGTTGAGTACATGCAACCGGAATTGGTTGATGGTGAACTGCAATTAGCGCCCGGATTTATATCTCCCCCTAATTCTGATTATATTGGCTATCATCAATACATAGACGATTTCCTACCTGAAGAGACTCCATATCTATACGGTCTTCATCCTAATGCAGAAATTGGATATTTAACAACTGTATCAGAACGTCTCTTCAAGGTCGTGTTCGAAATGCAGCCAAGGGACAGCGGTGCTCAGGCCGGCGGAGGCGCTACTAAAGAAGAATTGGTACGCTACATGCTAGACGACATCTTAGACCGGGTCCCCGAGCCCTTCAATCTACAAGAGCTGATGGGAAAGGTGGAAGAGCTGACTCCTTATACGATTGTCGCTCTGCAGGAGTGTGAACGTATGAACCGATTGATGGGTGAAATCAGACGATCGCTGAAAGAGTTGGAGCTTGGTTTGAAGGGTGAACTCACAATCAGCAATGACATGGAAAAGCTAATGGAGTCACTGTTCATGGACAATGTCCCGGACTCGTGGACCAAGCTTGCGTATCCCAGTCTACTGGGCTTGGCGGCGTGGTTCTCGGATCTGTGCCTGCGTTTGACTGAATTGGAGAATTGGTCCGGTGACTTTAATCTGCCACCTGCAGTGTGGTTAGCAGGGTTCTTCAACCCGCAGTCGTTCCTGACCGCTATCATGCAACAGACAGCCCGAAAAAATGAGTGGCCTCTAGACAAGATGTGTCTCAACTGCGACGTCACTAAGAAGAGCCGACAAGACTTCAATGCGCCACCCCGCGAAGGTGCAAACGTGCACGGTCTGTACATGGAGGGCGCTCGCTGGGACACGGCCACCGGCGGCATCGTCGAGTCCCGCATGATGGAGCTCTTCCCCATGATGCCAGTCATTTACGTCAAGGCCGTCACACAGGACAAACAAGACACCAGGAACGTTTACGAATGTCCCGTTTATAAGATACGCATGCGAGGACCTACTTTCGTGTGGACATTCAACTTGAAGACAAAAGATAAGCCCACGCGCTGGACACTGGCGGGCGTCGCCTTACTGCTCGGAGTGTAA
Protein
MGTIEFWKKSPWKKIDADGMDQECKRFTKDLRQLDKEMRVWEPYLVIEGIIKNLLTSLRAVTDLQNPAIKDRHWIELMMATKKSLHLNLMTINSHPSSPSTSSLERNVIFEEVLEDFKSIEECAKGIEIHTLYKEVKFHIDDDTTLADLLALSLHKYEEEVKTIVDKSVKEAAMEKTLRELEATWAIMEFDYTTHDRTGTKLPKASEELVETLEDNQNQVQNMMSSKFIGFYETEVTVWQKKLGTADAVIALWFEVQRKWQYLESIFVGSDDIRSQLPEDSKRFDGIDKTFKELLKDIGVTPNVVQATNKPGLLDKLEDLMKALNLCEKALNDYLETKRLAYPRFYFVSSADLLDILSNGNNPPAVCRHLTKLYDNLAKLVFPKPGSKQAYEMISKENEEHVPFKAPCCDCSGKVELWLNRVTDCMRYTLRDIFEHCVKSYEDKSRDEWVFDWPAQPALVGTQIWWTTETNQAFAKLEEGYENALKDYQKKQIAQLNALIVLLLSDLTVGDRQKIMTICTIDVHSRDVVAKLIVAKVETSNAFQWQSQLRHRWDSNLNNCFANICDAQFLYDYEYLGNTPRLVITPLTDRCYITLTQSLHLIMGGAPAGPAGTGKTETTKDLGRALGIMVYVFNCSEQMDYKSCGNIYKGLAQTGAWGCFDEFNRISVEVLSVVSVQVKSVLDAIKAKKKKFDFMGEYITLISTVGMFITMNPGYAGRTELPENLKALFRPCAMVVPDFELICEIMLVAEGFQEARLLARKFITLYMLCRELLSKQDHYDWGLRAIKSVLVVAGSLKRSDRQRPEDQVLMRALRDFNIPKIVTDDTPVFMGLIGDLFPALDVPRKRDMDFEKSLIEGALSMKLQPEPGFILKMVQLVELFAVRHSVFIIGFAGTGKSMVWQCLYKTYYLLKQKPFYNDLDPKAVTNDELFGVINQATREWKDGLFSTIMRDMANMPGDGPKWIVLDGDIDPMWIESLNTLMDDNKVLTLASNERIALTKSMRLLFEISNLRTATPATVSRAGILYINPQDLGWNPFVASWIDTTRDDESEKAMLTIMFDKYIPSLLESCKKYKRITPLTDLQQIQLTCYLLECFLNKSLLPSDCPKEWYETYFAFSVVWGFGSGLFQDQLVDWRNEFSKWFCNEFKQIKFPSTGNVFSFFIDPETKKFLPWSEKVESFELDPDLPLQSCLVSTSETTRIRFFMDLLLAKQKPVMLVGSAGSGKTVSVAAKLNSLPESYAITNVPFNFYTTSEMMQKVLEKPLEKKSGRNFGPPGSKFMIYFVDDLNMPEVDTYGTVQPHTLIREFMDYKHWYDRQKLSLKEISNCMFVACMNPTAGSFTIDPRLQRHFCTFAVSFPGIDACFHIYKQILSQHVNNPLNKFGPLVQRYAEPLVNAALTLHNKLASAFLPTAIKFHYIFNLRDLSNIFQGMLFTTGDAIKTQSDLIRLWMHEATRVYSDKMVEEADNEAFQKLISEVIKKNCEDYDENVVFEKPLIYCHFAEGVGDPKYFPIRDWPQVKKLLDESLSSYNDLVATMNLVLFEDAMYHICRINRILEAPRGNALLVGVGGSGKQSLSRLSAFISSLEVFQIQLRKGYSINDLKVDLATLYIKSGLKNLGNVFLMTDAQVADERFLVLINDLLASGEIPELLADDEIENIINGVRGETKASGVPDTRENCWRFFINRVRTMLKVVLCFSPVGATLRIRARKFPSIVNCTAINWFHEWPREALRSVSKRFISEVESLPPDLVDPVSNFMSHVHQSVNQMSAVYFQNERRYNYTTPKTFLEQISLYTKLLNEKTTNLKMMIARLENGLEKLASCAADVAVLKVTLAEQEIILKEKNRAAEALIEVVGAESEKVSKEKAFAAEEEKKVKVIEEDVTIKAKICADDLAKAEPALLAAQEALNTLNKNNLTELKSFGSPPDAVVNVTAAVLVLFSKKGKIPKDRSWKSCKSIMAKVDQFLNDLVFYDKENIHPDVIKAVMPYIKNPEFNAEFIMSKSAAAAGLCAWVINIVKFYDVYVVVEPKRRALNQANAELQAARDKLAFLTDQIKELEEKLEVLLKAFQEAVNEKMKCQAEADATNATIDLANRLVNGLASEKIRWSATVVNLKESGVMLPGDVLLITAFISYVGCFMRGYRQQLMYEDWIPTLQKTNPKIETTEGLDPLSMLTDDAQVACWNNEGLPTDSMSTENATILTNSARWPLMIDPQLQGIKWIKSRYGDSLVVIRLTQRNYLDRIERAVTNGNVVLLENIGETVDAVLEPLLGRVLIRKGKVLKIGDREIDYHPNFRLVIQTKLANPHYQPEMQAQCTLINFTVTRDGLEEQLLGEVVKAERPDLESLRAGLTKQQNDFKITLKTLEDDLLKRLSSAGPDILSDSALVINLEITKKTAADIEIKVEEGKITAVKIDEARERYRRAANRASLLYFILNEIYKINPMYQFSLKAYSVVFRDALARAEPADDLEGRVRNLLDSITFSVFVYTSRGLFERDKLVFLFLITLQVLQGEGKIDPRELDFLLKYAVAPEVSPYSWLSNNSWGGIVALSKMDAFENLDKDIEGATKRWQKYTDGEAPERDKLPGEWKNKTSLQRLCIMRALRPDRMSYASSAFCEENLGTKYVEARTPPIEKSYQESNSTTAMFFILSAGVDPLKDLEKLGRKLGFSTDKKNFHIVSLGQGQEIVAEEAMGVASANGHWVILQNIHLVAKWLATLEKKMEETFENPLPEYRLYLSAEPAADPAYHIIPQGILESAIKITNEPPIGMWANLHKSLDNFNQETLEMCSKEAEFKSVLFALCYFHAVVAERRKFGPQGWNRVYPFNFGDLTICVYVLYNYLEANPRVPWEDLRYLFGEIMYGGHITDDWDRRLCRTFLVEYMQPELVDGELQLAPGFISPPNSDYIGYHQYIDDFLPEETPYLYGLHPNAEIGYLTTVSERLFKVVFEMQPRDSGAQAGGGATKEELVRYMLDDILDRVPEPFNLQELMGKVEELTPYTIVALQECERMNRLMGEIRRSLKELELGLKGELTISNDMEKLMESLFMDNVPDSWTKLAYPSLLGLAAWFSDLCLRLTELENWSGDFNLPPAVWLAGFFNPQSFLTAIMQQTARKNEWPLDKMCLNCDVTKKSRQDFNAPPREGANVHGLYMEGARWDTATGGIVESRMMELFPMMPVIYVKAVTQDKQDTRNVYECPVYKIRMRGPTFVWTFNLKTKDKPTRWTLAGVALLLGV

Summary

EMBL
BABH01019865    RSAL01000001    RVE55311.1    KQ460045    KPJ18099.1    AGBW02009658    + More
OWR50189.1    KQ459604    KPI92405.1    CH477265    EAT45561.1    DS231835    EDS32929.1    ATLV01022415    KE525332    KFB47643.1    GEZM01060890    JAV70834.1    AAAB01008987    EAA01375.5    KQ971354    EFA05849.1    AXCN02000255    APCN01000904    ADMH02001484    ETN62377.1    AXCM01003407    APGK01058382    APGK01058383    APGK01058384    APGK01058385    KB741288    ENN70692.1    JXUM01026200    JXUM01026201    JXUM01026202    JXUM01026203    KQ560749    KXJ81025.1    GEZM01060889    JAV70835.1    KB632370    ERL93731.1    KK853064    KDR11876.1    GAMC01017766    JAB88789.1    OUUW01000005    SPP80619.1    CH479179    EDW24041.1    KQ971307    KYB29781.1    EFA11309.2    CH964232    KRF99354.1    GU937422    ADF80169.1    KRF99355.1    KRF99353.1    CM000070    EDY67828.2    BK005628    DAA05701.1    BK006568    DAA06397.1    AAZO01003313    DS235271    EEB14162.1    ODYU01012953    SOQ59508.1    CCAG010012076    CCAG010012077    AAZO01003396    AAZO01003397    DS235281    EEB14320.1    JRES01000409    KNC31586.1    KK107077    EZA60545.1    EU417452    ABY85408.1    RSAL01000038    RVE51134.1    CP007106    EAL24525.4    QOIP01000009    RLU18201.1    JH816371    EKC20777.1    EU417447    ABY85403.1    KQ981572    KYN39778.1    EU417450    ABY85406.1    GGFK01000870    MBW34191.1    GL888565    EGI59469.1    CH477538    EAT39332.1    KQ982691    KYQ52109.1    KQ767877    OAD53287.1    KQ977141    KYN05431.1    AXCN02001753    KQ434980    KZC13060.1    DS232111    EDS35091.1    KQ980612    KYN15119.1    KQ978644    KYN29472.1    AF210453    AAF21041.1    GL888084    EGI67861.1    KQ435706    KOX80265.1    GL444028    EFN61360.1    EU417444    ABY85400.2    ATLV01018849    KE525251    KFB43381.1    AAAB01008849    EAL41019.3    ADTU01010327    ADTU01010328    ADTU01010329    ADTU01010330    JXUM01075435    KQ562886    KXJ74924.1    APCN01005160    ADTU01005848    ADTU01005849    KQ977642    KYN01090.1    KQ976738    KYM75717.1   
Pfam
PF03028   Dynein_heavy        + More
PF18198   AAA_lid_11
PF12780   AAA_8
PF18199   Dynein_C
PF17852   Dynein_AAA_lid
PF08385   DHC_N1
PF17857   AAA_lid_1
PF12777   MT
PF12774   AAA_6
PF08393   DHC_N2
PF12781   AAA_9
Interpro
IPR035699   AAA_6        + More
IPR041658   AAA_lid_11       
IPR042228   Dynein_2_C       
IPR041228   Dynein_C       
IPR041466   Dynein_AAA5_ext       
IPR004273   Dynein_heavy_D6_P-loop       
IPR013602   Dynein_heavy_dom-2       
IPR042219   AAA_lid_11_sf       
IPR013594   Dynein_heavy_dom-1       
IPR024317   Dynein_heavy_chain_D4_dom       
IPR024743   Dynein_HC_stalk       
IPR027417   P-loop_NTPase       
IPR042222   Dynein_2_N       
IPR041589   DNAH3_AAA_lid_1       
IPR035706   AAA_9       
IPR003593   AAA+_ATPase       
IPR026983   DHC_fam       
IPR036084   Ser_inhib-like_sf       
SUPFAM
SSF52540   SSF52540        + More
SSF57567   SSF57567       
Gene 3D
PDB
5NUG     E-value=0,     Score=2113

Ontologies

Topology

Length:
3224
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
7.86459999999999
Exp number, first 60 AAs:
0.00935
Total prob of N-in:
0.00179
outside
1  -  3224
 
 

Population Genetic Test Statistics

Pi
25.929881
Theta
190.683152
Tajima's D
0.616087
CLR
0.697314
CSRT
0.546122693865307
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号