SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14714
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 3.441
 

Sequence

CDS
ATGTCGTCGGGGAACTCACCCCCGTTAATCAGCACACCCGGCCCGTCCAATAAGGGACGTCAGGCGACTCACAAGCCAACACCTGCAACCCGTACAAGCTTGACGGGACTCGGGTTGGACAGCCAGCCCGGGCCTTCGGTCGCGGCCCAGGGGTCCCCGAGGATCGGACCGAGGGAAGGTAATCTTCCCTCGTTGACCGATCCCTCCGGGCCCTCTCGGCCGCGGAAGAAGGCCAGGTCTGAGTCTGACCGAGGCTCGTCAAGCGACAAGGATAAGCGTCCGCGACTGGGTCCTTCCTCCAGATCGGAGGGAGAGGAAAGTGCGACCACATCCACCGATCATTCCTCAACTGAATCCGTGACTCCTTCCACGTCTAGATCTTCGTCCCCCTCTGGGAGCCCAATCCCAGCCAATAAACCAATTCCGAAGCCTAGGGCCCCCGCCAGGACAGGGACAGCCCTTAGGCAACTACGATCCCCTCCACGCTCTCCCTCCCCAACGTTATCCCCAATCCCGGTGGACTCAACCCGAGGTGCCCCCGCCCTAAGCGGCACGGCGGGCAACCTGGATTCCACCAGGTATATGGACCTCGAGTCCACCAGACCCCAACATATTCCCTTACCGACAAACCCCAAGCCTTCTACCTCCTACGCTGCCATGGCAGCTAGGCCAGGTATTCCTACCACCCAGAGGACTTCCCAATCCCCAAAAGCCCCTCCCCCGAGGTCGAAGGGTCGTGCCCAGGAGGTATTACGTCGACACCCACCAATTATGGTGGAGGCCCTCCCGAATTGGCCTCGCCATTTGGCGGCCATTAGGGAGCGCTTAGGTCGAGCTCCCTCGGCGCAACCCTTCGGCGCCGGTTTTAGATTTCTGCCGACGTCGGTCGAGGAGTACAGGGCGGTCCAGGCCTACCTGTCGGAGGCCTCTGCCAGGGATGGTACCATTAAATGGTACTGTTATGCCCTGGCGGAGGAGATGCCTTCTAAGGTGGCGGTCCGGGGCCTCCCTGCCGACACCGACGAGGCAGAAATAGTCAATGCCCTGAAGGAGCTGGGATTCCCGGCTCGATATGCCAGGTGCATCAGGTCCCAGAGAGGGCGACCGGGCTGCGTGTTTCACGTAGCCCTGGACCACCTCTCAAGGGACGACCTCGCCCGCTTGTACGCAGTCAACGAACTGTTGTACTTGCCGGGGGTGACAGTTGAGGGATGGCGTCCAACCCGAGGGCCCGCGCAGTGTCATCGCTGCCAGGCCTTCGGACACGCATCCTACAACTGCCATCGCGCGGTCCGCTGCGTAAGGTGTGCCGGAGAGCACATTGTAGCGGACTGCCCGAGGCCGAGGGACGGCCCATTCTCCTGCGCCAATTGTGGGAAGGACCACGTCGCCGTCGACAGACGGTGTGCGGTCTTCCGCAAACGGGCCAGGATGATGGGAGTCACCGTCCCTCCTCCTGCGCCACCGGTGCCTCGAGCCGGGGGTGCAGCTCCTCCGGCTGTACTTCCCATAGTAAGGGGGAAGGGGAAGGGGAAAGGGAAATCTTCCCTTCCCCCGGCCCCTCCCCCTCGAAACTCCATTCCGTCCGCCGTGGTAGTGGAGGCTGAGCCGTCAGCGACCACGTTGATGGCGCAGGCCAACCGGCCGCGGCGGACAAATAAACCCATTCCCGTTCCTCGTGGTCGCACTTCCGCTGGTGTCACACCTACACCTCGCCCGACCGGCGGTCCTGCACCCGGAAAAAATAGTAATAGGAACAAAAAGAAAAAACAAAAGAAAAAAGATAAAAAAAAAGAAGCACGAGAGAGAGAGGAAGCCATCAGAGATGATGATGCTGCACCTCTCGAACAATCCCAAATGGTCGTTGAGACAATGGAGGTCAACGAGGCCTCCCCTACTGCCCAAACATCGAACTCCAATCCGCCATTGCCATCGGCCCATCTGGCCGAAGACAATTCTAATCTGAACAGCCAGCCCCCCCTTCCCCCCGCCCTCAGCGCGAGCGCCGCAGCGGTCGACAGGCCTCTCAGCCTGCCGGCTTTGCTGCATGGCTGCTCACACTGTGGGAAAAATTGTCCGAGTTCAATGGCTAGCCAGGAGCTGCGCATCATTTATTGGAACCCCGACGGGATAAAGTCCCGAAAGAACGACCTGCTTGTTCTCGCCCGGGAGTACAACCCTGAGGTTCTGCTCCTGGGCGAGACCTTGTTAAAACCTCAGGATGTGTTCAGGATTCCCAACTACTTCATGTACCGACGTGACGAGCTTACCCCTGCCGGGCGGCCGTTCAGGGGCACTGCGGCCCTTGTCAGGCGGGACGTGGTGCATGATCAGTTGGATTTGCTGTCCTTCTCATCGACAAGGTCAGTCGGTGTGAGGGTACACACCTCGGGGGGAGATATGCGGATTTATGCCGCGTATAGACCCCCGGGGCCTGAATTCCACCCTGAGGATATAAGACGGGCCCTGAATTACGACAGCCGCCCAGCTCTGCTGGTCGGGGACCTCAACGCGAAGCACGTCGCGTGGGGTTCCCGACTTAACACAGCAGTGGGCAGGCGGCTGTTAGAAGATGCCGATAGGGGCGACTACTCTGTGGTCGGCCCTGATGAACCCACGCACGTCCCGACCGCCGCGCGATACCAGCCCGATGTGCTGGACGTGTGTGTTCATAAGGGGCTACGGTGCCCCGTAACGATCGAGGCACTGTACGACCTGGGTACCCCACATCTCCCTGTCCTGGTGACACTGGGAATGGGGCTCACCCGGGACCCCAACACCCCTGAGGGGGTCGATGACGCGGCAGTCCGCCTTATCGACTCCATCAGGGGAGCGATTGACCAGGCGACGACTCTTGTGCCCAGCGGCGGGCCCAGAGGTAGACTCCCGGCCCATCTGAAGGCGATCATTCGCCGGAAGAGGGGCCTGAGGAGGCTCTGGGCGACAACTCGTTGTCCCAGGATCAAGCGCGAGCTTAATGAGTTGGAAGCGGAGTTGGCGGCGAAGATTAGCTCCTTTCGGGGCTATGCGTGGGAGGAACGGATTGAGGAGGCCCGTGAGGACCCCTCTTCCGTGTCCCTCCACCGACTTTGCCGCCAGCTCTCAAATCGGCCTGCCCCGACTTGTCCACTCGTGGACGAGAGGGGCAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATGTCCTGGCCGCAATGCTGGAGCGGCAGTTCGTTCCGAATGACTCTGCACCCTCAGAGGCCGCATTCCACCAATCGGTGGAAGAGAGCGTAGCGAACCTACTCTCCTCCCCGGTGCCACCGTTGGGAGATGATGTTTTCATCACTCCCAGTGAATTGCGCCTCTCCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGTGAGGACGGTATTCCCTCCCTCGCATTCTTTCATTTCCCTGAAACGGTCGTGTCATATATGACACGGCTGTTCAATTCCATTCTGTCCACAGGACACTTCCCGGGAATTTGGAAATTGGGCAAGGTTATCGCCTTGCCCAAACCCGGCAAGGATAGGAGAATTCCCTCCAGTTACCGTCCGATCACCTTGCTGTCGCATGTGGGCAAGTTGTTCGAGAGGCTGCTGCTGAGAAGGGTGTCGCCGCACATCCTTCCCAGACCCGAGCAGTTCGGGTTTCGCAGCGGTCACTCGACAACGCTGCAATTGGTCCGCGTCATGCATCACTTGGCGGATCGGTCCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGATATCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGATCCACAAGTTGGTGCAGAACACGGACCTCCAGCACGCCTACGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCTTTGTCGCGGTCGAGGGCGCCAAGTCGTCGGTGCGCCCAGTCTCGGCCGGAGTTCCCCAGGGAAGCGTCCTGGCTCCATTCCTCTACGCTCTCTACACCAACGACATTCCCACGCTCGAGGGTAACCTCCAAGCGTGGGAAGTAGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCTCGTCATCCAACGTCCCCTCTGCGGCCATTCTGAGGATGCAGAGGCTTTTGGACTTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACTGCGGCTATCCTCTTCGGTCCGGTCCGCACAACAGTCGTCCCGGGACAGCTCAGTCTCCGTGGCGCTAATGTCGAGTTTAGATCCAGCGTCCGGTACTTGGGGGTCGATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAGTAAGGCGTTGGCGGCCGCTCGCTGTGCGAGATTCCTCCTCCGGCCGGTGTTGGCCTCTAGGTTGCCGGTCAGGACTAAGCTCGGCATTTATAAGACGTATGTCCGTTCCCGTATCACGTACGCAGCTGAGGCCTGGTATCACCTCATCCCGCAGGGTATGCGGGCGAGGTTACAGGTCCAGCAAAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGAAATGACGTAATCGCCCGGGATCTGGATGTGGAGTCGCTCGAGGAGTTCATCCGGAGGCTAGCTCGTAATCTTTACGAGCGGGCTGACGGTGGACCCCACGAGCACCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTCGGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGGTAAGATAG
Protein
MSSGNSPPLISTPGPSNKGRQATHKPTPATRTSLTGLGLDSQPGPSVAAQGSPRIGPREGNLPSLTDPSGPSRPRKKARSESDRGSSSDKDKRPRLGPSSRSEGEESATTSTDHSSTESVTPSTSRSSSPSGSPIPANKPIPKPRAPARTGTALRQLRSPPRSPSPTLSPIPVDSTRGAPALSGTAGNLDSTRYMDLESTRPQHIPLPTNPKPSTSYAAMAARPGIPTTQRTSQSPKAPPPRSKGRAQEVLRRHPPIMVEALPNWPRHLAAIRERLGRAPSAQPFGAGFRFLPTSVEEYRAVQAYLSEASARDGTIKWYCYALAEEMPSKVAVRGLPADTDEAEIVNALKELGFPARYARCIRSQRGRPGCVFHVALDHLSRDDLARLYAVNELLYLPGVTVEGWRPTRGPAQCHRCQAFGHASYNCHRAVRCVRCAGEHIVADCPRPRDGPFSCANCGKDHVAVDRRCAVFRKRARMMGVTVPPPAPPVPRAGGAAPPAVLPIVRGKGKGKGKSSLPPAPPPRNSIPSAVVVEAEPSATTLMAQANRPRRTNKPIPVPRGRTSAGVTPTPRPTGGPAPGKNSNRNKKKKQKKKDKKKEAREREEAIRDDDAAPLEQSQMVVETMEVNEASPTAQTSNSNPPLPSAHLAEDNSNLNSQPPLPPALSASAAAVDRPLSLPALLHGCSHCGKNCPSSMASQELRIIYWNPDGIKSRKNDLLVLAREYNPEVLLLGETLLKPQDVFRIPNYFMYRRDELTPAGRPFRGTAALVRRDVVHDQLDLLSFSSTRSVGVRVHTSGGDMRIYAAYRPPGPEFHPEDIRRALNYDSRPALLVGDLNAKHVAWGSRLNTAVGRRLLEDADRGDYSVVGPDEPTHVPTAARYQPDVLDVCVHKGLRCPVTIEALYDLGTPHLPVLVTLGMGLTRDPNTPEGVDDAAVRLIDSIRGAIDQATTLVPSGGPRGRLPAHLKAIIRRKRGLRRLWATTRCPRIKRELNELEAELAAKISSFRGYAWEERIEEAREDPSSVSLHRLCRQLSNRPAPTCPLVDERGNRCFSAQARADVLAAMLERQFVPNDSAPSEAAFHQSVEESVANLLSSPVPPLGDDVFITPSELRLSIKRMKRRKAPGEDGIPSLAFFHFPETVVSYMTRLFNSILSTGHFPGIWKLGKVIALPKPGKDRRIPSSYRPITLLSHVGKLFERLLLRRVSPHILPRPEQFGFRSGHSTTLQLVRVMHHLADRSNARQYTAAVFLDIEKAFDRVWHAGLIHKLVQNTDLQHAYVRLLGSYLEGRSFFVAVEGAKSSVRPVSAGVPQGSVLAPFLYALYTNDIPTLEGNLQAWEVDVKLALFADDSAYFSSSNVPSAAILRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTTVVPGQLSLRGANVEFRSSVRYLGVDIDRSLRMTAHASKALAAARCARFLLRPVLASRLPVRTKLGIYKTYVRSRITYAAEAWYHLIPQGMRARLQVQQNLALRTIVGAGRYVRNDVIARDLDVESLEEFIRRLARNLYERADGGPHEHLHNIAPLHARPPDGRALPRELLEPPAMVR

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=5.95252e-05,     Score=116

Ontologies

Topology

Length:
1577
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00364
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1577
 
 

Population Genetic Test Statistics

Pi
325.247732
Theta
207.022802
Tajima's D
1.630128
CLR
0.499225
CSRT
0.816259187040648
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号