SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14712
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Full name
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 2.011
 

Sequence

CDS
ATGGCTAGCCAAGAGCTTCGCGTCATCTATTGGAACCCCGACGGGATAAAGTCCCGGAAAAACGAGCTGCTTGTTCTCGCCCGGGAGTACAACCCTGAGGTTCTGCTCCTGGGCGAGACCTTGTTAAAGCCTCAGGATGTGTTCAGGATTCCCAACTATTTCATGTACCGACGTGACGAGCTTACCCCTGCCGGGCGGCCGTTCAGGGGCACTGCGGCCCTTGTCAGGCGGGACGTGGTGCATGATCAGTTGGATTTGCTGTCCTTCTCATCGACAAGGTCAGTCGGTGTGAGGGTACACACCTCGGGGGGAGATATGCGGATTTATGCCGCGTATAGACCCCCGGGGCCTGAATTTCACCCTGAGGATATAAGACGGGCCCTGAATTACGACAGCCGCCCAGCTCTGCTGGTCGGGGACCTCAACGCGAAGCACGTCGCGTGGGGTTCCCGACTTAACACAGCAGTGGGCAGGCGGCTGTTAGAAGATGCCGATAGGGGCGACTACTCTGTGGTCGGCCCTGATGAACCCACGCACGTCCCGACCGCCGCGCGATACCAGCCCGATGTGCTGGACGTGTGTGTTCATAAGGGGCTACGGTGCCCCGTAACGATCGAGGCACTGTACGACCTGGGTACCCCACATCTCCCTATCCTGGTGACACTGGGAATGGGGCTCACCCGGGTTGCGACTTCGCCCCTACGACCGAAGGTCGACTGGGAGCTCTTTAAGAGACGACTAGTCGACCTTCCCGTAATTCAGGACCCCAACACCCCTGAGGGGGTCGACGACGCGGCAGTCCGCCTTGTCGACTCCATCAGGGGAGCGATTGACCAGGCGACGACTCTTGTGCCCAGCGGCGGGCCCAGAGGTAGACTCCCGGCCCATCTGAAGGCGATCATTCGCCGGAAGAGGGGCCTGAGGAGGCTCTGGGCGACAACTCGTTGTCCCAGGATCAAGCGCGAGCTTAATGAGTTGGAAGCGGAGTTGGCGGCGAAGATTAGCTCCTTCCGGGGCTACACGTGGGAGGAACGGATTGAGGAGGCCCGTGAGGACCCCTCTTCTGTGTCCCTCCACCGACTTTGCCGCCAGCTCTCAAATCGGCCTGCCCCGACTTGTCCACTCGTGGACGAGAGGGGCAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATGTCCTGGCCGCAATGCTGGAGCGGCAGTTCGTTCCAAATAACTCTGCACCCTCAGAGGCCGCATTCCACCAATCGGTGGAAGAGAGCGTAGCGAACCTACTCTCCTCCCCGGTGCCTCCGTTGGGAGATGATGCTTTCATCACTCCCAGTGAATTGCGCCTCTCCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGTGAGGACGGTATTCCCTCCCTCGCATTCTTCCACTTCCCTGAAACGGTCGTGTCATATATGACACGGCTGTTCAATTCCATTCTGTCCACAGGACACTTCCCGGGAATTTGGAAATTGGGCAAGGTTATCGCCTTGCCCAAACCCGGCAAGGATAGGAGAAATCCCTCCAGTTACCGTCCGATCACCTTGCTGTCGCATGTGGGCAAGTTGTTCGAGAGGCTGCTGCTGAGAAGGGTGTCGCCGCACATCCTTCCCAGACCCGAGCAGTTCGGGTTTCGCAGCGGCCACTCGACAACGCTGCAATTGGTCCGCGTCATGCATCACTTGGCGGATCGGTCCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGATATCGAGAAAGCCTTCGACCGTGTCTGGCATGCGGGACTGATCCACAAGCTGGTGCAGAACACGGACCTCCAGCACGCCTACGTGCGATTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCTTTGTCGCGGTCGAGGGCGCCAAATCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCTCAGGGAAGCGTCCTGGCTCCATTCCTCTACGCTCTCTACACCAACGACATTCCCACGCTCGAGGGTAACCTCCAAGCGTGGGAAGTAGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCTCGTCATCCAACGTCCCCTCTGCGGCCATTCTGAGGATGCAGAGGCTTTTGGACTTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACTGCGGCTATCCTCTTCGGTCCGGTCCGCACAACAGTCGTCCCGGGACAGCTCAGTCTCCGTGGCGCTAATGTCGAGTTTAGATCCAGCGTCCGGTACTTGGGGGTCGATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAATAAGGCGTTGGCGGCCGCTCGCTGTGCGAGATTCCTCCTCCGGCCGGTGTTGGCCTCCAGGTTGCCGGTCAGGACTAAGCTCGGCATTTATAAGACGTATGTCCGTTCCCGTATCACGTACGCAGCTGAGGCCTGGTATCACCTCATCCCGCAGGGTATGCGGGCGAGGTAA
Protein
MASQELRVIYWNPDGIKSRKNELLVLAREYNPEVLLLGETLLKPQDVFRIPNYFMYRRDELTPAGRPFRGTAALVRRDVVHDQLDLLSFSSTRSVGVRVHTSGGDMRIYAAYRPPGPEFHPEDIRRALNYDSRPALLVGDLNAKHVAWGSRLNTAVGRRLLEDADRGDYSVVGPDEPTHVPTAARYQPDVLDVCVHKGLRCPVTIEALYDLGTPHLPILVTLGMGLTRVATSPLRPKVDWELFKRRLVDLPVIQDPNTPEGVDDAAVRLVDSIRGAIDQATTLVPSGGPRGRLPAHLKAIIRRKRGLRRLWATTRCPRIKRELNELEAELAAKISSFRGYTWEERIEEAREDPSSVSLHRLCRQLSNRPAPTCPLVDERGNRCFSAQARADVLAAMLERQFVPNNSAPSEAAFHQSVEESVANLLSSPVPPLGDDAFITPSELRLSIKRMKRRKAPGEDGIPSLAFFHFPETVVSYMTRLFNSILSTGHFPGIWKLGKVIALPKPGKDRRNPSSYRPITLLSHVGKLFERLLLRRVSPHILPRPEQFGFRSGHSTTLQLVRVMHHLADRSNARQYTAAVFLDIEKAFDRVWHAGLIHKLVQNTDLQHAYVRLLGSYLEGRSFFVAVEGAKSSVRPVTAGVPQGSVLAPFLYALYTNDIPTLEGNLQAWEVDVKLALFADDSAYFSSSNVPSAAILRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTTVVPGQLSLRGANVEFRSSVRYLGVDIDRSLRMTAHANKALAAARCARFLLRPVLASRLPVRTKLGIYKTYVRSRITYAAEAWYHLIPQGMRAR

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
RSAL01000708    RVE41206.1    NWSH01000895    PCG73652.1    ABLF02008153    ABLF02008462    + More
ABLF02008464    ABLF02023911    ABLF02034467    GEZM01008457    JAV94772.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    GGMR01004661    MBY17280.1    NEVH01011985    PNF31054.1    NEVH01021205    PNF19912.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    NEVH01017470    PNF24199.1    GFTR01008279    JAW08147.1    GALX01005299    JAB63167.1    NEVH01005277    PNF39135.1    GFTR01008262    JAW08164.1    GBBI01004395    JAC14317.1    ABLF02028535    ABLF02028545    GGFL01004957    MBW69135.1    NEVH01026386    PNF14434.1    ABLF02041767    ABLF02042518    ABLF02057746    GBGD01000415    JAC88474.1    NEVH01007402    PNF35856.1    GGFL01005012    MBW69190.1    NEVH01016302    PNF25823.1    KK119261    KFM75202.1    NEVH01006736    PNF36716.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    ABLF02008605    ABLF02008608    ABLF02008609    ABLF02008610    ABLF02017023    GFTR01008261    JAW08165.1    KQ973342    KXZ75569.1    GGMS01002992    MBY72195.1    GGMR01003407    MBY16026.1    NEVH01023979    PNF17579.1    NEVH01008277    PNF34262.1    NEVH01001347    PNF42959.1    NEVH01021925    PNF19341.1    NEVH01016340    PNF25410.1    NEVH01015305    PNF27092.1    GFXV01000908    MBW12713.1    GALX01005359    JAB63107.1    GFTR01007929    JAW08497.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GGMR01018716    MBY31335.1    AB055391    BAB21761.1    NWSH01007753    PCG62823.1    NEVH01020940    PNF20481.1    LBMM01018163    KMQ83860.1    X17551    CAA35587.1    NWSH01000032    PCG80496.1    AB018558    BAA76304.1    AY508487    AAS13459.1    GBBI01003747    JAC14965.1    GBGD01000389    JAC88500.1    KK118005    KFM71947.1    NEVH01023280    PNF18085.1    GFTR01008246    JAW08180.1    ABLF02017813    GFTR01008257    JAW08169.1    AY047531    AAK77263.1    GFTR01008251    JAW08175.1    ABLF02055645    GGMR01006408    MBY19027.1    GGMR01013409    MBY26028.1    GBBI01004571    JAC14141.1    ABLF02017815    GFTR01008254    JAW08172.1    GBBI01003810    JAC14902.1    M22874    M38643    GGMS01006359    MBY75562.1    GGMR01012443    MBY25062.1    GEZM01084969    JAV60363.1    GGMS01017365    MBY86568.1    GEDC01000337    JAS36961.1    ABLF02050434    ABLF02064867    NEVH01002556    PNF42024.1    GGMR01016296    MBY28915.1    U07847    AAA17752.1    GFTR01008269    JAW08157.1    AF081103    AAC72921.1    GDHC01020244    JAP98384.1    GFTR01008038    JAW08388.1    GFDL01000006    JAV35039.1    KU543687    AMS38379.1    GECL01003538    JAP02586.1    KU543673    AMS38352.1    GGMR01012305    MBY24924.1    LBMM01012041    KMQ86458.1    KQ971729    KYB24751.1    GEZM01053022    JAV74219.1    KQ459265    KPJ02064.1    GFTR01008260    JAW08166.1    NEVH01014858    PNF27387.1    NEVH01005295    PNF38784.1    GGFJ01001822    MBW50963.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF07727   RVT_2
PF03372   Exo_endo_phos
PF03184   DDE_1
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR004875   DDE_SF_endonuclease_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=4.30071e-05,     Score=115

Ontologies

Topology

Length:
824
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02512
Exp number, first 60 AAs:
0.00017
Total prob of N-in:
0.00048
outside
1  -  824
 
 

Population Genetic Test Statistics

Pi
22.638004
Theta
30.079003
Tajima's D
1.607721
CLR
0.000828
CSRT
0.809159542022899
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号