SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14609
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Full name
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 2.143
 

Sequence

CDS
ATGCGGACTTTCCGGGGTGACTCCTGGGAGGGGGGACTGTTGGACGCGTCCGACGACCGTACGATGGCCCCCCTTCGCCGCATCTGTCGCCGGCTCACCCACAAGCCTTCCCCCACTTGTCCCCTGGAGGATGAGGCGGGAAGACGGTGTTTTACACCGGTGGCTCGTGCCGAAGTCCTGGCCAACTCGCTGGAGGGGCAGTTCACTCCGAATGTCTCTGCACCCTCGATGGTTGCATTCCATCGGGAGGTGGCAGAGGGTGTAATCCAACTCCTCAAATCGGAATCGCCGGGAGTCGAGCTGGGAGATGACGATCTAGTCACTCCCAGCGAGGTGCGCCTCCTCATCAAGTTGATGAAGAGGCGCAAAGCCCCCGGCGAGGACGGTATTCCTCCCCTCGCCCTGCAAAACCTCCCACCCTCAATCGTGTCAGCAATGACACGATTGTTTAATTCCATTCTCCGGGTAGGACACTTCCCTGGAACTTGGAAATTGGGCAAGATTATCGTCTTGCCCAAACCCGGCAAGGACAGGAGAAAGCCCTCCAGTTACCGACCGATTACCTTGCTGTCGCACGTGGGCAAGTTGTTCGAGCGGCTGCTTCTGAGGAGAATATCGCCGTATATTCTCCTCAGGCCGGAGCAATTCGGCTTTAGAAGCGGCCACTCGACGACTCTGCAACTGACCCGTGTCCTGCATCACTTGGCGGACCGGCGTAACTCGGGCCAATACACGGTCGCAGTCCTTCTCGATATCGAGAAGACCTTCGACCGTGTGTGGCACGAGGGGTTGGTCCACAAGCTGCGGGACGCGGGCCTACCGCACGCTCACGTGCGACTGCTCGGGTCGTATCTGGAGGGCAGAACCTTCTTTGTCGCGGTCGAGGGCGCTCGGTCTTCCGTGCGTCCCATTACGGCCGGAGTTCCTCAGGGTAGTGTCCTATCTCCTATCCTATACGCCCTCTACACCAATGACATCCCCACCCTGATGGGTCACCTTCGGGCGTGGGAGGAGGACGTGAAGTTGGCCTTGTTCGCTGACGACTCGGCCTACTTCTCGTCCTCTCCGTTCCCCTCTGCAGCCATTATGAGGATGCAGAGGCTTTTGGATTTACTGCCCCAGTGGCTGGACCGTTGGAGAGTCGCGGTCAATGTGGGAAAGACCGCGGCCTTACTCTACGGTCCGGTCCGTATCAGAGTCGTCCCAAAGAAACTCAGTCTCCGAGGTGTGAATGTCGAGTTCAGGACCATGGTCCGGTATCTCGGATGCGACATCGACCGCTCCTTGAGCATGGTCGCGCACGTCAACCGAGTCATCGGTCAGACTCGCGCGGCCAGGTTCTTGCTGCGGCCGGTACTTGCGTCCGGGCTTCCGACCAGGACCAAACTCGCCATTTACAAGACATACGTCCGTTCCCGCCTCACATACGCTGCTGAGGCCTGGTATCACCTGTTGTCGCCGTCCCAGCGATCTAGGTTGCAGGCCCAGAGTCTTTCCCTCCGTAATATCGTCGGGGCCGGGCGGTACGTCAGAAATGACGTCATCGCCCGGGACCTAGGGGTGGAGTCGCTCAGGGAGTTCGTGACTAGGCTCGCTCGTAATATGTACGAGCGAGCCGAAAACGGCCCCATGAGCATCTCCACAACATAG
Protein
MRTFRGDSWEGGLLDASDDRTMAPLRRICRRLTHKPSPTCPLEDEAGRRCFTPVARAEVLANSLEGQFTPNVSAPSMVAFHREVAEGVIQLLKSESPGVELGDDDLVTPSEVRLLIKLMKRRKAPGEDGIPPLALQNLPPSIVSAMTRLFNSILRVGHFPGTWKLGKIIVLPKPGKDRRKPSSYRPITLLSHVGKLFERLLLRRISPYILLRPEQFGFRSGHSTTLQLTRVLHHLADRRNSGQYTVAVLLDIEKTFDRVWHEGLVHKLRDAGLPHAHVRLLGSYLEGRTFFVAVEGARSSVRPITAGVPQGSVLSPILYALYTNDIPTLMGHLRAWEEDVKLALFADDSAYFSSSPFPSAAIMRMQRLLDLLPQWLDRWRVAVNVGKTAALLYGPVRIRVVPKKLSLRGVNVEFRTMVRYLGCDIDRSLSMVAHVNRVIGQTRAARFLLRPVLASGLPTRTKLAIYKTYVRSRLTYAAEAWYHLLSPSQRSRLQAQSLSLRNIVGAGRYVRNDVIARDLGVESLREFVTRLARNMYERAENGPMSISTT

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
RSAL01000708    RVE41206.1    NWSH01000895    PCG73652.1    ABLF02055645    ABLF02017815    + More
GEZM01074951    JAV64378.1    ABLF02050434    ABLF02064867    ABLF02017813    ABLF02008463    ABLF02008153    ABLF02008462    ABLF02008464    GGMS01017914    MBY87117.1    GGMR01004661    MBY17280.1    ABLF02021177    ABLF02027367    ABLF02066338    ABLF02023911    ABLF02034467    ABLF02028535    ABLF02028545    ABLF02040650    ABLF02040651    ABLF02056776    ABLF02041767    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GEZM01008457    JAV94772.1    ABLF02033522    KK117880    KFM71667.1    NEVH01017559    PNF23833.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    NEVH01020071    PNF21969.1    NEVH01023961    PNF17613.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01023962    PNF17612.1    AB018558    BAA76304.1    NEVH01018383    PNF23463.1    NEVH01003017    PNF40781.1    NEVH01007443    PNF35684.1    NEVH01010546    PNF32261.1    NEVH01000280    PNF43672.1    NEVH01001355    PNF42855.1    KQ973342    KXZ75569.1    NEVH01019080    PNF22876.1    GALX01005299    JAB63167.1    NEVH01019964    PNF22161.1    JXUM01155316    KQ572171    KXJ68070.1    KQ971729    KYB24751.1    NEVH01005938    PNF38077.1    AB055391    BAB21761.1    NEVH01007838    PNF34986.1    NEVH01014858    PNF27387.1    NEVH01006754    PNF36554.1    KK119261    KFM75202.1    NEVH01002716    PNF41415.1    U07847    AAA17752.1    NEVH01019376    PNF22596.1    NEVH01011985    PNF31054.1    NEVH01021205    PNF19912.1    ABLF02029306    ABLF02029314    ABLF02060138    AY089343    AAL90081.2    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    NEVH01026154    PNF14491.1    NEVH01023280    PNF18085.1    ABLF02014862    ABLF02014866    ABLF02061908    NEVH01000269    PNF43694.1    NEVH01017470    PNF24199.1    M22874    M38643    NEVH01017542    PNF24034.1    ABLF02003961    ABLF02059872    GFDL01000004    JAV35041.1    GFTR01008038    JAW08388.1    NEVH01022639    PNF18527.1    KQ459265    KPJ02064.1    GGMS01000737    MBY69940.1    NWSH01000032    PCG80497.1    GGMS01008766    MBY77969.1    ABLF02066620    NEVH01002704    PNF41489.1    NEVH01005277    PNF39135.1    GBYB01008290    JAG78057.1    NEVH01011193    PNF32021.1    PCG80496.1    KQ459259    KPJ02068.1    GFTR01008279    JAW08147.1    GGMS01012005    MBY81208.1    GBBI01004395    JAC14317.1    LBMM01018163    KMQ83860.1    GBBI01004571    JAC14141.1    KK117974    KFM71881.1    GGMR01010373    MBY22992.1    GFTR01008246    JAW08180.1    AF081103    AAC72921.1    GFXV01005866    MBW17671.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GGMS01004685    MBY73888.1    GBHO01016496    JAG27108.1    GGMS01006359    MBY75562.1    NEVH01006736    PNF36716.1    KK113014    KFM59099.1    KK116089    KFM66762.1    GGMS01004444    MBY73647.1    GFTR01008262    JAW08164.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03184   DDE_1
PF07530   PRE_C2HC
PF07727   RVT_2
PF03372   Exo_endo_phos
PF10551   MULE
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR004875   DDE_SF_endonuclease_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR036875   Znf_CCHC_sf       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=4.69649e-06,     Score=122

Ontologies

Topology

Length:
549
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02101
Exp number, first 60 AAs:
2e-05
Total prob of N-in:
0.00247
outside
1  -  549
 
 

Population Genetic Test Statistics

Pi
238.588198
Theta
152.964977
Tajima's D
2.898327
CLR
27.346522
CSRT
0.973751312434378
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号