SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14573
Pre Gene Modal
BGIBMGA008740
Annotation
unnamed_protein_product_[Bombyx_mori]
Transcription factor
Location in the cell
Nuclear   Reliability : 3.483
 

Sequence

CDS
ATGGAGTTATCTGCTGCAAGTCTCTTAACACAGCTTATGATACGTGTCTCGACTCGATTGTTGTCCCATATTACCATAAAGCAACACATATGCTGGTCAGACAGTACCATTGTCCTAGCATGGCTAAACCCACCTCCTCATAGACTTCAGGTCTTTGAAGCTAACAGGGTTGCCAAGATAACATCCAATCCAATCACCTCCACATGGAAACATGTTCCTACAAACCTGAACCCTGCAGACTGTGCGAGCAGGGGAATGTCTGCCCAGTCACTATCGGCTCATGATCTTTGGTGGTCTCCTAGCTGGCTGAAGGAGCCTCCTGACACCTGGCCCAAAATGCCTCCTGCTCTAGGCCACCATGCATTACCAGGTCTGAAGCCCAAGAAAGTACCAGCTCATATAGCAGTTCCTGACCTCGACCTTGACTTGCTTACTCGATTCAGTTCTCTCGACAAGCTCGTTGGAGTGACAGCTTGCATAAAACGCTTTATTTTCAATTGTAGACACAACTCAACTGATAGGCGCTCTGGTCCCTTGACAGTTGGAGAACGTAGAGATGCTCTGTTATTCTGGGTTCGCTCTGTTCAACACAATGAGTTTGCGGAAGATATTTACCGTCTTCAGGCAGGCAAGATTTGTACCGTTCGACTTCAGCGTCTTTCACCCTTGATGAAAGATGATCTCTTGAGAGTTGGTGGTCGCCTCACTCATGCGCCAATAAGATACGATGCTCAGCATCCTCTCGTTCTGCCCAGCTCTAGCCCACTAGTTGATCTCATCATAGACCACTATCACAGAATAAACTGTCATCCTGGGGCTAACACATTACACGCTATCCTCCGTCAGCAGTTCTGGATACTCTCAGCACGTCGTGTCATCAGGCATCGCGTGTACAAATGCATTAGATGTTTCCGATATCGCGCTCAGGCCAGGGCTCCGTTGATGGCTGATTTGCCCGCAGACAGAGTCACACCCCAGCCACTCATCCAAGCTCTCTCTCAGCGTTTTTGGACTCTGTGGACCAAATCCTATCTCCATACCCTCCAAACCCGCTCCAAATGGCTTTCCACATCCTCACCTCCTCAAGTTGGAGAGCTCGTCCTCATCAAAGAGGACAATCAGCCCCCGCTGCAATGGAAACTTGGAAGGATTATCCGCACGTTACCCGGCAAGGATGGAGTGATCAGAGTCGTGGATTTAGACACGAAGCATGGAAGTCTGCGGAGACCTGTGTTCAATGGAAGGGCTGTGGGAGATCGGGTTTACCCTGAAGCACATGCGGGCGATTTCCGCACACTCGGGCCAACTGGGTTGCCTGATGTTTGTTCAGCTACAACAACGTCCCGGGCATATACGAAGTACGAGAACTACTTTGTATGCCCGGGGCTATCATCAAAGCCTGGCGCGGAAGGAGGGATCCAGTTCAATGGCATAGATGCCAACAATTTCGGCACTCCTCGCACAATTGCCACGGGCCTGTCGCCTGCTGATGTGGAGGATGAGGAAGATGTGGAGGATTTGGAGGATGAGGAGGATGTGGAGGATGAGGAGGATGTGGAGGATGAGGAGGATGTGGAGGATGAGGAGGATGTGGAGGATGAGGAGGATGTGGAGAATGAGGAGGATGTGGAGGATGAGGAGGATGTGGAGGATGTGGAGGATGAGGAGGATGTGGAGGATGAGGAGGATGTGGAGGATGAGGAGGATGAGGAGGATGTGGAGGATGAGGAGGATGTGGAGGATGAGGAGGATCTTTCGTCGTCCGCGCAATGGTCGACCGCGATATGCGACCAATGCATCGATACGCTTCGCAGCTCTGTGGACTTCAGACGGCAGGTGTTGCGTGTCGAGCAGCAACTGTTGGAGAGGACTAAAGCATTAGAAGATGGTATAGTCGAAGTGAAAACGGAGCCCTTGGACGTGAATGGCGGAGAAGATTCCGACGATTACTTTCTGCCTTGCACCGAAGTGAAGATTAAGAAGGAACCGAAGCCAGATATAAAGAAGCGTCACAGAAGTGTGAGGGAGAAGTGTGTCGGCGTGAATCCCGAGTGGGAGGGAGATGACACCAACATTCCAACAAACAATCGGGTCGACGCCAAAGACAAGGAAAAGAGCATGAAAAGGATCAAGAGGAGAACAGTTACTATTGAAAGGTCAAAAGTTAAACTCCAATGGACCAGAACAGCTATAGCTGACAAGATGAAGCACCGGGAGAACTTGCTTACGGTCTTGAAGTATTCGAACGCGACACCCTTCAAGAAGAAGTCGTTGGTCGGCTTTAGTTGCGCGTATTGCGAGGGGGCGTACCCCGACCCGGGCGAGCTGCGGCGCCACACCCGCGCCGAGCATGCCGCCCAGCGCCTGGAGCTCCGACCCGCGCGCGACCTCTCCCAGTACTACGTCAATCTGGACGTGGACAACCTCGCCTGCACGCTCTGCGAGAAAACCCTCGACAACCTAACTACCCTCAAGGAGCACCTGACTAAAACCCACCAGAAAACCTTCCACGCGGACATCAAGGACCACATCCTCGAGTTTAAGCTGAAGAGCGGCGACGTTTTCGACTGCGCCAAGTGCGCGTCCACGTACGAGACGTTCAAGATGCTGAAGCAGCACATGAACAAGCACTACAGCAACTACGTGTGCGGGAAGTGCGGGACCGCGTTCGCGACCAAGAGGTCCCTGCACTCGCACCGGAACGTGCACAAGGAGGGCAGCTACAAGTGCGGCTACTGCGACAAGGTGTTCTCGAACCGTCCCAAGAAGTGCTACCACGAGAAGCTGCAGCATCTGGGCGAGAGCAACATCTCGAAGTGCCAGCACTGCGGTGCGCCCTTCAAGAGCTACTACCAGCGGAACCAGCACCTGATCCGGGTGCACAACGACGAGGCCAAGTACAAGTGCAACGTCTGCAACAAGAGCTATCTGCTCAAATCGCTGCTCATGTACCACATAAAGAGGAATCACTTGCTGGAGAGGAACTGCCAGTGCACGGAGTGCGGCTACCGGTTCTTCAGCAAGAAGGCTCTGAAGGCGCACATGGTCCGGCACACGGGCGAGCGGATATACGCGTGCGAGGTCTGCGGCAAGGCGTACGCCAGGAAGTACACCCTGAGGGAGCACATGCGCATCCACAACAACGACCGGCGGTTCAAGTGCCACGTGTGCAGCCTGACCTTCGTGCAGAAGTGCAGCTTGAAGAGTCATCTGCTGTCGAACCACGGGATCAGCGTGGCGGCCTGCGAGATCACCATGACGACAAATTGA
Protein
MELSAASLLTQLMIRVSTRLLSHITIKQHICWSDSTIVLAWLNPPPHRLQVFEANRVAKITSNPITSTWKHVPTNLNPADCASRGMSAQSLSAHDLWWSPSWLKEPPDTWPKMPPALGHHALPGLKPKKVPAHIAVPDLDLDLLTRFSSLDKLVGVTACIKRFIFNCRHNSTDRRSGPLTVGERRDALLFWVRSVQHNEFAEDIYRLQAGKICTVRLQRLSPLMKDDLLRVGGRLTHAPIRYDAQHPLVLPSSSPLVDLIIDHYHRINCHPGANTLHAILRQQFWILSARRVIRHRVYKCIRCFRYRAQARAPLMADLPADRVTPQPLIQALSQRFWTLWTKSYLHTLQTRSKWLSTSSPPQVGELVLIKEDNQPPLQWKLGRIIRTLPGKDGVIRVVDLDTKHGSLRRPVFNGRAVGDRVYPEAHAGDFRTLGPTGLPDVCSATTTSRAYTKYENYFVCPGLSSKPGAEGGIQFNGIDANNFGTPRTIATGLSPADVEDEEDVEDLEDEEDVEDEEDVEDEEDVEDEEDVEDEEDVENEEDVEDEEDVEDVEDEEDVEDEEDVEDEEDEEDVEDEEDVEDEEDLSSSAQWSTAICDQCIDTLRSSVDFRRQVLRVEQQLLERTKALEDGIVEVKTEPLDVNGGEDSDDYFLPCTEVKIKKEPKPDIKKRHRSVREKCVGVNPEWEGDDTNIPTNNRVDAKDKEKSMKRIKRRTVTIERSKVKLQWTRTAIADKMKHRENLLTVLKYSNATPFKKKSLVGFSCAYCEGAYPDPGELRRHTRAEHAAQRLELRPARDLSQYYVNLDVDNLACTLCEKTLDNLTTLKEHLTKTHQKTFHADIKDHILEFKLKSGDVFDCAKCASTYETFKMLKQHMNKHYSNYVCGKCGTAFATKRSLHSHRNVHKEGSYKCGYCDKVFSNRPKKCYHEKLQHLGESNISKCQHCGAPFKSYYQRNQHLIRVHNDEAKYKCNVCNKSYLLKSLLMYHIKRNHLLERNCQCTECGYRFFSKKALKAHMVRHTGERIYACEVCGKAYARKYTLREHMRIHNNDRRFKCHVCSLTFVQKCSLKSHLLSNHGISVAACEITMTTN

Summary

Uniprot
ProteinModelPortal
PDB
5V3J     E-value=1.39946e-24,     Score=284

Ontologies

Topology

Length:
1089
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02231
Exp number, first 60 AAs:
0.02212
Total prob of N-in:
0.00097
outside
1  -  1089
 
 

Population Genetic Test Statistics

Pi
243.209859
Theta
170.84128
Tajima's D
0.885799
CLR
0.178537
CSRT
0.624568771561422
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号