SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14358
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 3.342
 

Sequence

CDS
ATGTCGGGGGGGAACCCACCTCCAACTATCAGCACACCCGGCCCGTCTCATAAGGGACGACAGGCAATGCCGGAAGTTCAATTACCAACACCAACACCTGCAATCCGTATGGCCCCGATGGGACCCGGTGCGGGCAGTTCGGCCGGGCCTTCGGCCGCGGCCAGGGGACCCCTGAGGATCGTACCGGTGGAAAGTAACTTTCCTACGTCGGCCGATCCCTCTGGGCCCTCTCGGCCGCGGAAGAAGGCCAGGTCAGAGTCTGACCGAGGCTCATCGGGCGACCAAGATAAACGCCCACGTATAGGCCCTTCCTCCAGGTCGGAGGGAGAAGAGAGCGTGACCACGTCCACGGATCACTCCTCTACCGAGTCTATTACTCCTTCCTCGTCAAGATCCACTTCCCCCTCTGGGAGTCCGATCCCAGTCCAACCCGTTCCTAAGCCTAGAGCACCCGCCAGGACAGGGATTGCTCCTAGGCAATTGAGAACCCCTCCTCACTCTCCTTCCCCAACCCTATCCCCAATCCCGGTGGACTCTACCCGAGGTGCCCCCGCCCTAAGCGGCACGGCGGGTAACCTGGACTCCACCAGGTATATGGACCTAGAGTCCACCAGACCGCATCACGCGCCTAAGACAAATCCTACGCCCTCTACCTCCTATGCTGCTATGGCAGCTAGGCCGGGTATCCCATCCATCCAGAGGACATCCCAATCCTCTCATGTCCCTCCCCCGAGGCCGAAGGGTCGTGCCCAGGAGGAGCTGCGCCGACATCCGCCAATAATGGTGGAGGCCCTCCCTAATTGGTCCCGCCACATGGCGGCCATTAGGGAGCGCCTTGGCCGCGCCCCCTCGGCGCGACCCTTCGGCGCCGGTTTTAGATTCCTGCCGACGTCGGTTGAGGAATACAGGGCGGTCCAGGCCTACCTGTCGGAGGCCTCTGCCAGGGATAGTACCATTAAATGGTACTGCTATGCCCTGACAGGGGAGATTCCGACCAAGGTGGCTGTCCGGGGCCTCCCTGCCGATACTGACGCGGCAGAAATAACCGATGCCCTGAAGGAGCTGGGGTTCCCGGCTCGTCACGCCAGGTGCATCAGGTCCCAGAGAGGGCGCCCGGGCTGCGTGTTTCACGTAGCCTTGGACCACCTCTCGAAGGACGACCTCGCCCGCCTGTACGCAGTCAACGAACTGCTGTACTTGCCGGGGGTGACAGTTGAGGGATGGCGACCAACCCGCGGGCCTGCGCAGTGTCATCGCTGCCAGGCCTTCGGGCACGCCTCGAACAATTGTCACCGAGCGGTCCGTTGTGTTCGATGTGCCGGGGAGCACGTCGTAGCGGACTGCCCGAGGCCGAGGGACGGCCCATTCTCCTGCGCCAATTGCGGGAAGGACCACGCCGCCGTTGATAGGCGGTGTCCGGTCTACCGCAAGAAGGCCAGGATGATGGGAGTAACCGTCCCTCCTCCTGCGCCAATGGTGCCTCGACCCGGGAACACAGCTCTTCCCTCTGTAGCTCCCATTCCAAAGGGGAAGGGGAAAGGGAAAGGGAAATCCTCCCAGCCCCAACCCCCTCCCCTGTCCTCACCCATCCCCCCTGCCGTCTCAGTGGAGGCCAATCCATCAGCGGCAACGCTGATGGCAGAGGCCAACGCTCCGCGGCGGGGTATACCTGTTCCTACCCCTCGTGGTTCACACGCTGTTAGACCGCCCCATCTAAAAAGCAGCGTTCCAGCTCGTGCTGGAACACAAGCCCCGCAAATATCAGGTCCTAAACAAAAAAAAAATCGGCTTAAAAAATTGAAAAAAAAGCAAAAAAAGAGAGCTCAACGGGATGCAGCGGTGAGTGCTCCTGCTGCACCGGCTCCCGCGGTATCTACAATGGAGGTGGACGTAAACCCACCCATCGACCCAACTTCTCAACCGATTTCACAATCGGGAACGACCCCACTGCCCCAGGCTCAACCAGCCATCTCGGGCATATCTCAGCCCCCTCTCCCCCCCCGCCCGCAGCGCGAGCGGCGCAGCGACCGACAGGCCTCACAGCCTGCCGGTTTCGCTGCCTGGCTTCTCGCATTGTGGGAGAAATTGTCCGAGGTGATCTCCGGAGTAATCCGTGAGATCGCCTCGGGAGCCAGTCCCTTTGGGGCTATCCTCCAAGAGCTTCGCATCATCTATTGGAACCCCGACGGGATAAAGTCCCGGAAAAACGAGCTGCTTGTTCTCGCCCGGGAGTACAACCCTGAGGTTCTGCTCCTGGGCGAGACCAAGCTACGTCCTCAGGATGCGTTCAGGATTCCAAACTACTTCATGTACCGACGTGACGAGCTTACCCCTGCCGGGCGGCCGTTCAGGGGCACTGCGGCCCTCGTCAGGCGGGACGTGGTGCATGATCAGTTGGATTTGCTGTCCTTCACATCGACAAGGTCGGTCGGTGTGAGGGTACACACCTCGGGGGGGGATATGCGGATTTATGCCGCGTATAGACCCCCGGGGCCTGAATTTCACCCTGATGACATAAGACGGGCCCTGAATCACGACAGCCGCCCAGCTCTGCTGGTCGGGGACCTCAACGCGAAGCACGTCGCGTGGGGCTCCCGACTTAACTCAGCAGTGGGCAGGCGGCTGTTAGAAGATGCCGATAGGGGCGACTACTCCGTGGTCGGCCCCGACGAACCCACACACATCCCGATCGCCGCGCGCTATCAACCCGATGTGCTGGATGTGTGTGTGCACAAGGGGCTACGGTGCCCCGTAACGATCGAGGCACTGTACGACCTGGGTACCCCACATCTCCCTATCCTGGTGACACTGGGAATGGGGCTCACCCGGGTTGCGACCTCGCCCCTACGACCGAAGGTCGACTGGGAGCTCTTTAAGAGACGACTAGTCGACCTTCCCGTGATTCAGGACCCCAACACCCCTGATGGGGTCGACGATGCGGCAACCCGCCTTGTTGACTCCATCAGGGGAGCGATCGACCAGGCGACGACTCTTGTGCCCAGCGGCGGGCCCAGAGGTATACTCCCGGCCCATCTGAAGGCGATTATTCGCCGGAAGAGGGGCTTGAGGAGGCTCTGGGCGACAACTCGTTGTCCCAGGATAAAGCGCGAGCTTAATGAGCTGGAAGCGGAGCTGGCGACAAAGATTAGCACCTTTCGGGGCTATGCCTGGCAGGAGAGGATCGAAGAGGCCCGCGAGGACCCCTCCTCAGTATCCCTCCACCGGCTTTGTCGCCAGCTCTCAAATCGGCCTGCCCCGACTTGTCCACTCGTGGACGAGAGGGGCAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATATCCTGGCCGAAATGCTGGAGCGGCAGTTCGCTCCTAATGACTCTGCACCCTCAGAGGCCGCATTCCACCAATCGGTGGAAGAGAGCGTAGCAAGCCTACTCTCCTCCCCGGTGCCACCGTTGGGAGATGGTGATCTCATCACTCCCAGCGAATTGCGCCTCATCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGCGAGGACGGTATTCCCTCCCTCGCTTTTTTCCACTTCCCTGAAACGGTCGTGTCATATATGACACGGCTGTTCAACTCCATCCTGTCCACAGGACACTTCCCGGGAATTTGGAAATTGGGCAAGGTTATCGCCTTGCCCAAACCCGGCAAGGACAGGAGAAATCCCTCCAGTTACCGTCCGATCACGCTGCTGTCGCACGTGGGCAAGTTGTTCGAGCGGCTGCTGCTGAGAAGGGTGTCGCCGCACATCCTTCTCAGACCCGAGCAATTCGGGTTTCGTAGCGGTCACTCGACAACGCTGCAATTGGTCCGCGTTATGCATCACTTGGCGGATCGGTCCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGACATCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGATCCACAAGCTGTTGCAGAACACGGACCTCCAGCACGCCTACGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCCTTGTCGCGGTCGAGGGCGCCAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCGCAGGGGAGCGTCCTGGCACCATTCCTCTACGCTCTCTATACCAACGATATTCCCACGCTCGAGGGCAACCTCCAAGCGTGGGAAGCCGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCGCGTCATCCAACTTCCCCTCTGCGGCCATTTCGAGGATGCAGAGGTTATTGGACTTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACTGCGGCTATTCTCTTCGGTCCAGTCCGCACAACAGTCGTCCCGGGACAGCTCAGTCTCCGTGGCGCTAATGTCGAGTTTAGATCCAGCGTCCGGTACTTGGGGGTCGATATCGACCGGAGTTTGAGGATGACCGCCCACGCCATGTCGGCGTTGGCGGCAGCTCGCTATGCGAGATTCCTCCTCCGGCCGGTGTTGGCCTCCAGGTTGCCGGTCAGGACTAAGCTCGGCATTTATAAGACGTATGTCCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGGGTATGCGGGAGAGGTTACAGGTCCAGCAAAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGAAATGACGTAATCGCCCGGGATCTAGATGTGGAGTCGCTCGAGGAGTTCATTCGGAGGCTAGCTCGTAATATGTACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTAGGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGGAAGCAGAGGACAGCAGCCGGCGCCGGGGTGTCACCGCCGCGGGCATCGAGCCGTCACCAGACTGCCCATCGTATTATATATAA
Protein
MSGGNPPPTISTPGPSHKGRQAMPEVQLPTPTPAIRMAPMGPGAGSSAGPSAAARGPLRIVPVESNFPTSADPSGPSRPRKKARSESDRGSSGDQDKRPRIGPSSRSEGEESVTTSTDHSSTESITPSSSRSTSPSGSPIPVQPVPKPRAPARTGIAPRQLRTPPHSPSPTLSPIPVDSTRGAPALSGTAGNLDSTRYMDLESTRPHHAPKTNPTPSTSYAAMAARPGIPSIQRTSQSSHVPPPRPKGRAQEELRRHPPIMVEALPNWSRHMAAIRERLGRAPSARPFGAGFRFLPTSVEEYRAVQAYLSEASARDSTIKWYCYALTGEIPTKVAVRGLPADTDAAEITDALKELGFPARHARCIRSQRGRPGCVFHVALDHLSKDDLARLYAVNELLYLPGVTVEGWRPTRGPAQCHRCQAFGHASNNCHRAVRCVRCAGEHVVADCPRPRDGPFSCANCGKDHAAVDRRCPVYRKKARMMGVTVPPPAPMVPRPGNTALPSVAPIPKGKGKGKGKSSQPQPPPLSSPIPPAVSVEANPSAATLMAEANAPRRGIPVPTPRGSHAVRPPHLKSSVPARAGTQAPQISGPKQKKNRLKKLKKKQKKRAQRDAAVSAPAAPAPAVSTMEVDVNPPIDPTSQPISQSGTTPLPQAQPAISGISQPPLPPRPQRERRSDRQASQPAGFAAWLLALWEKLSEVISGVIREIASGASPFGAILQELRIIYWNPDGIKSRKNELLVLAREYNPEVLLLGETKLRPQDAFRIPNYFMYRRDELTPAGRPFRGTAALVRRDVVHDQLDLLSFTSTRSVGVRVHTSGGDMRIYAAYRPPGPEFHPDDIRRALNHDSRPALLVGDLNAKHVAWGSRLNSAVGRRLLEDADRGDYSVVGPDEPTHIPIAARYQPDVLDVCVHKGLRCPVTIEALYDLGTPHLPILVTLGMGLTRVATSPLRPKVDWELFKRRLVDLPVIQDPNTPDGVDDAATRLVDSIRGAIDQATTLVPSGGPRGILPAHLKAIIRRKRGLRRLWATTRCPRIKRELNELEAELATKISTFRGYAWQERIEEAREDPSSVSLHRLCRQLSNRPAPTCPLVDERGNRCFSAQARADILAEMLERQFAPNDSAPSEAAFHQSVEESVASLLSSPVPPLGDGDLITPSELRLIIKRMKRRKAPGEDGIPSLAFFHFPETVVSYMTRLFNSILSTGHFPGIWKLGKVIALPKPGKDRRNPSSYRPITLLSHVGKLFERLLLRRVSPHILLRPEQFGFRSGHSTTLQLVRVMHHLADRSNARQYTAAVFLDIEKAFDRVWHAGLIHKLLQNTDLQHAYVRLLGSYLEGRSFLVAVEGAKSSVRPVTAGVPQGSVLAPFLYALYTNDIPTLEGNLQAWEADVKLALFADDSAYFASSNFPSAAISRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTTVVPGQLSLRGANVEFRSSVRYLGVDIDRSLRMTAHAMSALAAARYARFLLRPVLASRLPVRTKLGIYKTYVRSRITYAAAAWYHLIPQGMRERLQVQQNLALRTIVGAGRYVRNDVIARDLDVESLEEFIRRLARNMYERADGGPHEHLHNIAPLHARPPDGRALPRELLEPPAMEAEDSSRRRGVTAAGIEPSPDCPSYYI

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.000348209,     Score=110

Ontologies

GO

Topology

Length:
1648
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01438
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1648
 
 

Population Genetic Test Statistics

Pi
423.098917
Theta
197.899427
Tajima's D
3.469703
CLR
0.005206
CSRT
0.993750312484376
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号