SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13808
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Full name
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.948 Nuclear   Reliability : 1.26
 

Sequence

CDS
ATGGCTAGCCAGGAGCTGCGCATCATTTATTGGAACCCCGACGGGATAAAGTCCCGAAAGAACGACCTGCTTGTTCTCGCCCGGGAGTACAACCCAGAGGTTCTGCTCCTGGGCGAGACCTTGTTAAAACCTCAGGATGTGTTCAGGATTCCCAACTATTTCATGTACCGACGTGACGAGCTTACCCCTGCCGGGCGGCCGTTCAGGGGCACTGCGGCCCTTGTCAGGCGGGACGTGGTGCATGATCAGTTGGATTTGCTGTCCTTCTCATCGACAAGGTCAGTCGGTGTGAGGGTACACACCTCGGGGGGAGATATGCGGATTTATGCCGCGTATAGACCCCCGGGGCCTGAATTCCACCCTGAGGATATAAGACGGGCCCTGAATTACGACAGCCGCCCAGCTCTGCTGGTCGGGGACCTCAACGCGAAGCACGTCGCGTGGGGTTCCCGACTTAACACAGCAGTGGGCAGGCGGCTGTTAGAAGATGCCGATAGGGGCGACTACTCTGTGGTCGGCCCTGATGAACCCACGCACGTCCCGACCGCCGCGCGATACCAGCCCGATGTGCTGGACGTGTGTGTTCATAAGGGGCTACGGTGCCCCGTAACGATCGAGGCACTGTACGACCTGGGTACCCCACATCTCCCTGTCCTGGTGACACTGGGAATGGGGCTCACCCGGGTTGCGACTTCGCCCCTACGACCGAAGGTCGACTGGGAGCTCTTTAAGAGACGACTAGTCGACCTTCCCGTAATTCAGGACCCCAACACCCCTGAGGGGGTCGATGACGCGGCAGTCCGCCTTATCGACTCCATCAGGGGAGCGATTGACCAGGCGACGACTCTTGTGCCCAGCGGCGGACCCAGAGGTAGACTCCCGGCCCATCTGAAGGCGATCATTCGCCGGAAGAGGGGCCTGAGGAGGCTCTGGGCGACAACTCGTTGTCCCAGGATCAAGCGCGAGCTTAATGAGTTGGAAGCGGAGTTGGCGGCGAAGATTAGCTCCTTTCGGGGCTATGCGTGGGAGGAACGGATTGAGGAGGCCCGTGAGGACCCCTCTTCCGTGTCCCTCCACCGACTTTGCCGCCAGCTCTCAAATCGGCCTGCCCCGACTTGTCCACTCGTGGACGAGAGGGGCAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATGTCCTGGCCGCAATGCTGGAGCGGCAGTTCGTTCCGAATGACTCTGCACCCTCAGAGGCCGCATTCCACCAATCGGTGGAAGAGAGCGTAGCGAACCTACTCTCCTCCCCGGTGCCACCGTTGGGAGATGATGTTTTCATCACTCCCAGTGAATTGCGCCTCTCCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGTGAGGACGGTATTCCCTCCCTCGCATTCTTCCATTTCCCTGAAACGGTCGTGTCATATATGACACGGCTGTTCAATTCCATTCTGTCCACAGGACACTTCCCGGGAATTTGGAAATTGGGCAAGGTTATCGCCTTGCCCAAACCCGGCAAGGATAGGAGAATTCCCTCCAGTTACCGTCCGATCACCTTGCTGTCGCATGTGGGCAAGTTGTTCGAGAGGCTGCTGCTGAGAAGGGTGTCGCCGCACATCCTTCCCAGACCCGAGCAGTTCGGGTTTCGCAGCGGTCACTCGACAACGCTGCAATTGGTCCGCGTCATGCATCACTTGGCGGATCGGTCCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGATATCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGATCCACAAGTTGGTGCAGAACACGGACCTCCAGCACGCCTACGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCTTTGTCGCGGTCGAGGGCGCCAAGTCGTCGGTGCGCCCAGTCTCGGCCGGAGTTCCCCAGGGAAGCGTCCTGGCTCCATTCCTCTACGCTCTCTACACCAACGACATTCCCACGCTCGAGGGTAACCTCCAAGCGTGGGAAGTAGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCTCGTCATCCAACGTCCCCTCTGCGGCCATTCTGAGGATGCAGAGGCTTTTGGACTTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACTGCGGCTATCCTCTTCGGTCCGGTCCGCACAACAGTCGTCCCGGGACAGCTCAGTCTCCGTGGCGCTAATGTCGAGTTTAGATCCAGCGTCCGGTACTTGGGGGTCGATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAATAAGGCGTTGGCGGCCGCTCGCTGTGCGAGATTCCTCCTCCGGCCGGTGTTGGCCTCTAGGTTGCCGGTCAGGACTAAGCTCGGCATTTATAAGACGTATGTCCGTTCCCGTATCACGTACGCAGCTGAGGCCTGGTATCACCTCATCCCGCAGGGTATGCGGGCGAGGTTACAGGTCCAGCAAAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGAAATGACGTAATCGCCCGGGATCTGGATGTGGAGTCGCTCGAGGAGTTCATCCGGAGGCTAGCTCGTAATCTTTACGAGCGGGCTGACGGTGGACCCCACGAGCACCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTCGGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGGTAAGATAG
Protein
MASQELRIIYWNPDGIKSRKNDLLVLAREYNPEVLLLGETLLKPQDVFRIPNYFMYRRDELTPAGRPFRGTAALVRRDVVHDQLDLLSFSSTRSVGVRVHTSGGDMRIYAAYRPPGPEFHPEDIRRALNYDSRPALLVGDLNAKHVAWGSRLNTAVGRRLLEDADRGDYSVVGPDEPTHVPTAARYQPDVLDVCVHKGLRCPVTIEALYDLGTPHLPVLVTLGMGLTRVATSPLRPKVDWELFKRRLVDLPVIQDPNTPEGVDDAAVRLIDSIRGAIDQATTLVPSGGPRGRLPAHLKAIIRRKRGLRRLWATTRCPRIKRELNELEAELAAKISSFRGYAWEERIEEAREDPSSVSLHRLCRQLSNRPAPTCPLVDERGNRCFSAQARADVLAAMLERQFVPNDSAPSEAAFHQSVEESVANLLSSPVPPLGDDVFITPSELRLSIKRMKRRKAPGEDGIPSLAFFHFPETVVSYMTRLFNSILSTGHFPGIWKLGKVIALPKPGKDRRIPSSYRPITLLSHVGKLFERLLLRRVSPHILPRPEQFGFRSGHSTTLQLVRVMHHLADRSNARQYTAAVFLDIEKAFDRVWHAGLIHKLVQNTDLQHAYVRLLGSYLEGRSFFVAVEGAKSSVRPVSAGVPQGSVLAPFLYALYTNDIPTLEGNLQAWEVDVKLALFADDSAYFSSSNVPSAAILRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTTVVPGQLSLRGANVEFRSSVRYLGVDIDRSLRMTAHANKALAAARCARFLLRPVLASRLPVRTKLGIYKTYVRSRITYAAEAWYHLIPQGMRARLQVQQNLALRTIVGAGRYVRNDVIARDLDVESLEEFIRRLARNLYERADGGPHEHLHNIAPLHARPPDGRALPRELLEPPAMVR

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
RSAL01000708    RVE41206.1    NWSH01000895    PCG73652.1    ABLF02008153    ABLF02008462    + More
ABLF02008464    ABLF02023911    ABLF02034467    GEZM01008457    JAV94772.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    GFTR01008279    JAW08147.1    NEVH01011985    PNF31054.1    GALX01005299    JAB63167.1    NEVH01021205    PNF19912.1    ABLF02042518    ABLF02057746    NEVH01017470    PNF24199.1    GGMR01004661    MBY17280.1    GFTR01008262    JAW08164.1    ABLF02041767    GBBI01004395    JAC14317.1    NEVH01007402    PNF35856.1    GALX01005359    JAB63107.1    NEVH01026386    PNF14434.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    NEVH01016302    PNF25823.1    NEVH01005277    PNF39135.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GGFL01004957    MBW69135.1    ABLF02028535    ABLF02028545    NEVH01008277    PNF34262.1    GBGD01000415    JAC88474.1    NEVH01006736    PNF36716.1    NEVH01016340    PNF25410.1    KQ973342    KXZ75569.1    NEVH01015305    PNF27092.1    NEVH01023979    PNF17579.1    NEVH01021925    PNF19341.1    NEVH01001347    PNF42959.1    GGMR01003407    MBY16026.1    GFXV01000908    MBW12713.1    GFTR01008261    JAW08165.1    NEVH01020940    PNF20481.1    GGFL01005012    MBW69190.1    GGMS01002992    MBY72195.1    KK119261    KFM75202.1    GFTR01008246    JAW08180.1    GBGD01000389    JAC88500.1    GFTR01008257    JAW08169.1    GGMS01017365    MBY86568.1    ABLF02017815    NWSH01000032    PCG80496.1    GBBI01003747    JAC14965.1    X17551    CAA35587.1    GFTR01008254    JAW08172.1    GGMR01018716    MBY31335.1    AY508487    AAS13459.1    GGMR01006408    MBY19027.1    GBBI01003810    JAC14902.1    ABLF02055645    AB055391    BAB21761.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    GEZM01084969    JAV60363.1    AY047531    AAK77263.1    NWSH01007753    PCG62823.1    ABLF02008463    GFTR01008251    JAW08175.1    ABLF02008605    ABLF02008608    ABLF02008609    ABLF02008610    ABLF02017023    AB018558    BAA76304.1    GEZM01053022    JAV74219.1    AF081103    AAC72921.1    M22874    M38643    KQ971729    KYB24751.1    ABLF02021177    ABLF02027367    ABLF02066338    GEDC01000337    JAS36961.1    GFTR01008269    JAW08157.1    GGMS01006359    MBY75562.1    GGMR01000676    MBY13295.1    GGMR01012305    MBY24924.1    KQ459265    KPJ02064.1    GGMR01003864    MBY16483.1    GGFJ01001858    MBW50999.1    GGFJ01001822    MBW50963.1    KU543687    AMS38379.1    GFTR01008038    JAW08388.1    GGFJ01001857    MBW50998.1    GECL01003538    JAP02586.1    GFTR01007929    JAW08497.1    GFTR01008271    JAW08155.1    GEZM01074951    JAV64378.1    GGMR01012443    MBY25062.1    GFTR01008260    JAW08166.1    LBMM01012041    KMQ86458.1    U07847    AAA17752.1    NEVH01023280    PNF18085.1    GGMR01016296    MBY28915.1    KK118005    KFM71947.1    GGMR01000226    MBY12845.1    LBMM01018163    KMQ83860.1    KK119692    KFM76444.1    GFTR01008151    JAW08275.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=5.10109e-05,     Score=115

Ontologies

Topology

Length:
908
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00969999999999995
Exp number, first 60 AAs:
0.00018
Total prob of N-in:
0.00030
outside
1  -  908
 
 

Population Genetic Test Statistics

Pi
2.423226
Theta
164.265077
Tajima's D
-0.760474
CLR
20.943398
CSRT
0.187640617969102
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号