SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13376
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 3.34
 

Sequence

CDS
ATGCCTGGTGGGGCCTCGTCTCCGCCCATAATCAGCACTCCCGGCCCATCCCGTAAGGGACGTAAAGCGGCGGCAGTCATTTTTGCCCACCGCCCTTCATTCATTCCTGTCCCAGGTCGTATGGACCCTGATCCGGCAAACGGGCCTGGACCTTCTTCGGAGGCCCGGGGATCGCTCGGGATCCCTCGGCCTCGGAGGAAGGCCAGGTCCGGGTCGGACCAGGGTTCATCTGGGGCGGGCGATAAGCGCCCTAGGATTGGACCGTCACCACGGTCCAAGGAAGAGAGTGGCAGCGACGAGTACTCCTCCCCTGCCACATCATCATCATCATCCTCTTCTCCTTCATCCAGCGGCAGCCCTTCACCCTCCCCTCCTGCCAAACCGATACCCAAACCAAGGGTTCTTGCCAGGGCGGCGGAAGCCCACAGGCAACTGAGAACCCCTCCTCGTTCCCCCTCACCTCCTATATCTCCCATACCAGCGGTTCGGCCTCGAGGTACCCCTGCCCTAAGCAGCACGGCAGGCAACCTCGAATCAACGAGGTACGTGGACCTTGAGGCTACCCATTCCCATCCATATAACGCTGCTCAATCACAACACTCCCAATCAAAACCATCCACATCCTATGCAGCAATGGCTGCATCTCAATCATCCGGCCCCAAACGGCCCTCTATTCAAGCCCAAGTTGCCCCTCCCCCGAGGTCGAGGGGTCGTGCCCAGGTGGACTTACGCCGTCACCCATCAATTGTAGTGGAGGCCCTCCCTAATTGGCCTCGCCATATGGCGGCCATTAGGGAGCGGCTCGGCAGAGCTCCCTCGGCGCGACCCTACGGCGCCGGGTTCCGATTTCTCCCGTCGTCGATCGAGGAGTACAGGGAGGTCCAGGCCTACCTATCGGAGGTCTCTGCCAGGGACAGTGCCATTAAATGGTACTGTTATGCCCTGGCGGAGGACATTCCTTCGAAGGTAGTCGTTCGGGGCCTCCCTGTCGATACCGATGCGGCCGACGTAACCCAGGCCCTAAGAGAGCTGGGCTTCCCGGCCCGGCATGCCCGATGTATCGAGGCCAGGAGGGGTAGGCCAGGCTGCGTGTTTTTCGTGGCCTTGGACCACCTCTCCAAGGACGACCTCGCCCGGTTGTACGCAGTTGAAGAGCTGCTGTACTTGCCGGGGGTGTCAGTGGAGGGATGGCGTTCAGGTCGAGGGCCGGCGCAATGTCATCGTTGCCAGGCCTTTGGGCACGCATCCTCCAACTGCCACCGCGCGGTCCGCTGCGTTAGATGTGCTGAAGAGCACGTAGTAGCGGACTGCCCGAGGCCGAGGGATGGCCCGTTTTCTTGCGCCAACTGCGGAAGGGACGACACTGCCGTCGACAGACGGTGCCCGGTCTTCCGCAGAAGGGCAAGGATGATGGGAGTCACCATTCCCCCTCCGGTACCTCGGGCTCCACGGGCCGAGTTGCATCCGGCTCCGGTACTTCCGTCCTCATCTCAAGCTCCTAAGGGGAAGGGGAAAGGGAAAGGGAAACCCTCCCAGCCCCAGCCCCCTCCCCAGTCCCTATCCATACACCCCGTCGTTGTTGTAGAGGCTAAGTCGTCAGCGGCAACGCTGATGGCAGAAGCCAATGCTCCGCGACGGGGTAACAAACCTCTTCCTGCCCCTCGTAGTATTATCGCTGCCACTCAAGGTATGAATCAACCACCCGGGTCGCAGCCAGGAAATATAAGTGCTAATAATAAAGCCAGCAAAAATAAAAAGAAAAATAAAAATAAAAAAGAGAGAAGGAAATTAAAGAGAAAACTATTGATAGAAGCAGCCGTAGTCCTTCCTCCCCCTTCTCTAGCAACAGCAACAGTAGCAACAAACATACAAACGGCCCAAACCTCCTCAACAGCAATGGAGGTCGATGTTAAGACCCCTCATATCCCCGAAAGTAGCCAAGCCATTGATGCACAAGCCGTGACTGATGCCAACTTGCCTCAGTCGCAACCAACCTCATCTCAGCCCCTTCCCCCCCGCCCTCAGCGCGAGCAGCGCAGCGGTCGGCAGGCCTCACAGCCTGCCGGCTTTGCTGCATGGCTCCTCGCGCTCTGGGAAAAATTGTCCGAGGTGGTCTCCGGAGTGATCCGCGAGATCGCCTCGGGAGCCAGCCCTTTCGGGGCGCTCTTCCAGGAACTGCGCATCATTTATTGGAACCCCGGCGGGGTAAAAACCCGCAAGAACGATCTCTTGGTTCTCGCCCGGGAGTACAACCCTGAGGTTGTGCTCCTGGGCGAGACCAAGCTACGTCCTCGGGATGTGTTCAGGATTCCAAACTACTTCATGTACCGACGTGACGAGGTGAGTCCTGCCGGGACGCCGTTCAGGGGCACTGCGGCGCTCGTCAGGCGAGACGTGGTGCATGATCAGTTGGATTTGCTGGCCTTCACATCGACAAGGTCGATCGGTGTGAGGATCCACACCTCGGGGGGAGATATGCGGGTTTATTCCGCGTATAGACCCCCGGGGCCTGATTTTCACCCCGGGGACATAAGACGGGTCCTGAATTGCGACAGCCGCCCAGCTCTGCTGGTCGGGGACCTCAACGCGAAGCACGTCGCGTGGGGCTCCCGACTGAACTCAGCAGTGGGCAGGCAGCTGTTAGAAGATGCCGATAGGGGCGACTACTCTGTGGTCGGCCCCGACGAACCCACGCACATTCCGACCGCCGCGCAACTCCAGCCCGACGTGTTGGATGTGTGCGTTCATAAGGGGCTACGGTGCCCCTTAACTATTGAGGCACTGTACGACCTGGGTACCCCCCATCTCCCTATCCCGGTCACACTGGGAATGGGGCTCACCCGGGTTGCGACCTCGCCCCTACGACCGAAGGTCGACTGGGAGCTCTTTAAGAGACGCCTAGTCGACCTTCCCGCAATTCAGGACCCCAACACCCCTGAGGGGGTCGACGACGCGGCAGTCCGCCTTGTCGACTCCATCAGGGGAGCGATCGACCAGGCGACGACTCTTGTGCCCAGCGGCGGGCCCAGAGGTATACTCCCGGCCCATCTGAAAGCGATTATTCGCCGGAAGAGGGGCCTGAGGAGGCTCTGGGCGACAACTCGTTGTCCCAGGATCAAGCGCGAGCTTAATGAGCTGGAAGCGGAGTTGGCGGCGAAGATTAGCTCCTATCGGGGCTATGCGTGGGAGGAACGGATCGAGGAGGCCCGTGAGGACCCCTCGTCCGTGTCCCTCCACCGACTTTGCCGCCAGCTCTCAAATCGGCCTGCCCCGACTTGTCCACTCGTGGACGAGAGGGGCAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATGTCCTGGCCGTAATGCTGGAGCGGCAGTTCGCTCCAAATAACTCTGCAACCTCAGAGGCCGCATTCCACCAATCGGTGGAAGAGAGCGTAGCAAGCCTACTCTCCTCCCCGGCGCCACCGTTGGGAGATGGTGATTTCATCACTCCCAGTGAATTGCGCCTCTCCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGCGAGGACGGTATTCCCTCCCTCGCATTTTTCCATTTCCCCGAAACGGTCGTGTCATGCATGACACGACTGTTCAATTCCATTCTGTCCACAGGACACTTCCCGGGAACTTGGAAATTGGGCAAGGTTATTGCCCTGCCCAAACCCGGCAAGGATAGGAGAAATCCCTCCAGTTATCGTCCGATCACTCTGCTGTCGCATATGGGCAAGTTGTTCGAGCGGCTGCTGCTGAGAAGGGTGTCGCCGCACATCCTTCTCAGACCCGAGCAATTCGGGTTTCGCAGCGGTCACTCGACAACGCTGCAATTGGTCCGCGTTATGCACCACTTGGCGGATCGGTCCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGATATCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGATCTACAAGCTGTTGCAGAACACGGACCTCCAGCACGCCTATGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCCTTGTCGCGGTCGAGGGCGCAAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCCCAGGGAAGCGTCCTGGCACCAGTCCTCTACGCTCTCTACACCAACGACATTCCCACGCTTGAGGGCAACCTCCAAGCGTGGGAAGCCGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCGCGTCCTCTAATTTCCCCTCTGCGGCCATTTCGAGGATGCAGAGGCTGTTGGACCTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACCGCGGCTATCCTCTTCGGTCCGGTCCGCACAAGAGTCGTCCCAGGACAGCTCAGTCTCCGTGGAGTCAATGTCGAGTTTAGGCCCAGTGTCCGATACCTGGGAGTCAATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAAGTCGGCGTTGGCGGCCGCCCGCTATGCGAGGTTTCTCCTCCGGCCGGTGTTGGCCTCCGGGTTGCCGACCAGGACTAGACTCGGCATTTACAAGACGTATGTTCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGATCATGCGGGTGAAGTTACAGGCCCAGCAGAATCTGGCTCTTCGCACGATAGTCAGAGCAGGGCGTTACGTCAGAAATGACGTAATCGCCCGGGATCTAGATGTGGAGCCGCTCGAGCAGTTCATTCGGAGGCTAGCTCGTAATATGTACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTCAGGCGCTACCAAGGGAGCTACTGGAACCCCGGCTATGGGAGCTTCGTTCCGGGCAGTGGGGTTTGCCCCGAGGCCCGTTCCGTGCCCCCGAAAGGGGGTACGACGACCCTTCTTCTCTCTTCTCTCTCCTATCCCACGACCCTAACTTCTTACCGATTTTACTATGGGTAACTATACCAATTGTAAAATGA
Protein
MPGGASSPPIISTPGPSRKGRKAAAVIFAHRPSFIPVPGRMDPDPANGPGPSSEARGSLGIPRPRRKARSGSDQGSSGAGDKRPRIGPSPRSKEESGSDEYSSPATSSSSSSSPSSSGSPSPSPPAKPIPKPRVLARAAEAHRQLRTPPRSPSPPISPIPAVRPRGTPALSSTAGNLESTRYVDLEATHSHPYNAAQSQHSQSKPSTSYAAMAASQSSGPKRPSIQAQVAPPPRSRGRAQVDLRRHPSIVVEALPNWPRHMAAIRERLGRAPSARPYGAGFRFLPSSIEEYREVQAYLSEVSARDSAIKWYCYALAEDIPSKVVVRGLPVDTDAADVTQALRELGFPARHARCIEARRGRPGCVFFVALDHLSKDDLARLYAVEELLYLPGVSVEGWRSGRGPAQCHRCQAFGHASSNCHRAVRCVRCAEEHVVADCPRPRDGPFSCANCGRDDTAVDRRCPVFRRRARMMGVTIPPPVPRAPRAELHPAPVLPSSSQAPKGKGKGKGKPSQPQPPPQSLSIHPVVVVEAKSSAATLMAEANAPRRGNKPLPAPRSIIAATQGMNQPPGSQPGNISANNKASKNKKKNKNKKERRKLKRKLLIEAAVVLPPPSLATATVATNIQTAQTSSTAMEVDVKTPHIPESSQAIDAQAVTDANLPQSQPTSSQPLPPRPQREQRSGRQASQPAGFAAWLLALWEKLSEVVSGVIREIASGASPFGALFQELRIIYWNPGGVKTRKNDLLVLAREYNPEVVLLGETKLRPRDVFRIPNYFMYRRDEVSPAGTPFRGTAALVRRDVVHDQLDLLAFTSTRSIGVRIHTSGGDMRVYSAYRPPGPDFHPGDIRRVLNCDSRPALLVGDLNAKHVAWGSRLNSAVGRQLLEDADRGDYSVVGPDEPTHIPTAAQLQPDVLDVCVHKGLRCPLTIEALYDLGTPHLPIPVTLGMGLTRVATSPLRPKVDWELFKRRLVDLPAIQDPNTPEGVDDAAVRLVDSIRGAIDQATTLVPSGGPRGILPAHLKAIIRRKRGLRRLWATTRCPRIKRELNELEAELAAKISSYRGYAWEERIEEAREDPSSVSLHRLCRQLSNRPAPTCPLVDERGNRCFSAQARADVLAVMLERQFAPNNSATSEAAFHQSVEESVASLLSSPAPPLGDGDFITPSELRLSIKRMKRRKAPGEDGIPSLAFFHFPETVVSCMTRLFNSILSTGHFPGTWKLGKVIALPKPGKDRRNPSSYRPITLLSHMGKLFERLLLRRVSPHILLRPEQFGFRSGHSTTLQLVRVMHHLADRSNARQYTAAVFLDIEKAFDRVWHAGLIYKLLQNTDLQHAYVRLLGSYLEGRSFLVAVEGAKSSVRPVTAGVPQGSVLAPVLYALYTNDIPTLEGNLQAWEADVKLALFADDSAYFASSNFPSAAISRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTRVVPGQLSLRGVNVEFRPSVRYLGVNIDRSLRMTAHAKSALAAARYARFLLRPVLASGLPTRTRLGIYKTYVRSRITYAAAAWYHLIPQIMRVKLQAQQNLALRTIVRAGRYVRNDVIARDLDVEPLEQFIRRLARNMYERADGGPHEHLHNIAPLHARPPDGQALPRELLEPRLWELRSGQWGLPRGPFRAPERGYDDPSSLFSLLSHDPNFLPILLWVTIPIVK

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.000285445,     Score=111

Ontologies

Topology

Length:
1676
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.05038
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1676
 
 

Population Genetic Test Statistics

Pi
14.287351
Theta
23.710324
Tajima's D
-0.865062
CLR
108.020652
CSRT
0.160641967901605
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号