SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13270
Annotation
PREDICTED:_uncharacterized_protein_LOC105383084_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 2.571
 

Sequence

CDS
ATGGAAGAAATTAGTGAAAGTGTTATCAGTGACAGTGATTTTGTCGGGTTCCTCCGGGAAAGGTACCCGACAATTAGGGCCGAGTACGTTAGGTATAGGGCCTCTCGTGGCAATCCCTCTCCCCCCGGGTCCGTCGCCGCGTTTCTCAACCGTGCCTCGGAGGCACGCCGCGCGCCCCCCGCCGCCGCGTTAAGTTCGAGCGCACGTTCCGACGATGCGGCTCACATAGCGCCTAACGCTACCCCCACCCCCGCGCCCGCGTCGTTTACGTCATCGCGCTCTTCGTCCGTCGCGACCTCGATCGTTTCGAGTTCAGGCTCCGATACCGAATCGGAGATGGATTTCGAATCCGCGTCTAGCCCTCAGCCTGGAACCTCGGATGGGTTCCAAACCGTAACGCGCGGTAAAAAGCGTTCTCGCGCCGTGGAGTCCCGGAGCTCCACGACGAAGCAAACTAAATCCGCGACCGCCTCCCGCCCGCAGGTAGTCGTGACACCGGAGTCGGACTCCGCTCGCCGCGTAACCCCGCCGCCGCGTCCCAAGCCCGCGCCCGCTCCTAAAGTAGCTGCCCCGCCCCCGCTGATACTTCAAGAGAAGACAGCGTGGAATCGCGTGTCTCAGGCCCTTCAGGCCAACAAAATTAATTACACCCATGCGCGTAACGTCGCGCATGGGATTCAGATAAAGGTCGCAACGCCGGGCGACCATAGGGCCCTCTCTTCATACCTCCGAAAGGAGAACATAGGTTTTCACACCTATGCTCTTCAGGAGGACCGCGAGCTCCGCGTAGTGATACGCGGAGTCCCTAAGGAGTTAGACATCGATTACATAAAGGAGGATCTGACCGCTCAGTCCCTCCCGTTAGTTAGCGTGCACCGGATGCACAGTGGGCGGGGCAAGCAGCCCTACAACATGATCCTGGTAGCTCTAGAACCCACCCCGGAGGCCAAAAAGAAGATCGCATGTCTCACGACAATTTGCGGCCTATCCGGGATCTCGATCGAAGCCCCCCATAAGCGTGGCACTCCCGGGCAGTGCTACAGGTGCCAACTCTATGGCCACTCGGCGCGTAATTGCCACGCGCGTCCCCGCTGCGTGAAGTGCCTCGGCGATCACGCTACGTTAGATTGCGTTAGAGATAGGGAAACCGCGACCGAACCCCCAAGTTGTGTCCTATGCCTTAAGCAAGGGCACCCCGCGAACTACCGTGGATGTCCTAGGGCTCCGCGCAAGCGTTCAACCCTCCCAGCTCCGCGAACCGTCGGCCCAAAGACTTCGGCACCCTCAGTGCCGAAACCTGCCTTCGTGCCGGCTGCAGTTCCCACGGTTTCAGCGTGGAAAAAGCCGCTGCCGTATACGAAGGCGGGAACGCAAACCGCACCCCCGCCCCCGCTCGCGACACGCCCCGCGCCTCAGCCCCTGCTCGCACCTCGCCCCGCGCCCGCGTTCCGTCCCCCGCAACCCTCTGCCGCCAACGACTTCGCGCTCGTGCGCGACTTCGTCACCGCGGTGAACTTCGACCGTCTGCGATCGTTCGCTGACGCTATCCGTAGGTCGACAACCCCCGAACAGCGGCTCGCGGCCGCGTTCGATCACATGGACGTTTACGAGTCCGTGTCGCCATTCTACAATGCTAACGGACTCGCGCGTCAACGCGATCAAATTTTCGAATTCCTCCGCGACAATCTTATAGATATCTTATTAGTGCAGGAGACCTGTCTGAAGCCCTCGCGTCGCGACCCGAAAGTCGCGAACTACGTCATGGTTAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTATAGACGGGCCCTGCACGTTGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTCCTGAGCAGTGACATCGAGTCACTGTTCGGCATGGGAGACTCCGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAATTGCCATCGTACAAACGTGAACGGTAGGCGTCTCGACGCGTTTATAGACGACCTCACCTTCGAAATAGTCGGTCCCCCAACTCCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCATTGCTTAGGAACGTAACTCTGCGCTTGCGTTCCATCGAAGCAATGTCAGAGCTCGACTCAGACCACCGACCTGTCGTTATGCAGCTCGGTCGCCCTCACAACCCAGTCACTGTTACGAGGACCATGGTGGATTGGAATAAGCTGGGCACGTGCCTAGCCGACGCCGCTCCGCCAATCCTCCCTTGCGGCCCGGATTCGAATCCATCCCCCGAGGACACCGTCGAATCCATAAACATCATTACCGATCACATCTCTTCCGCGATCATTAGATCTTCAAAAGAAGTCGATGTGGAGGACAGCTTCCACCGCATCAGACTGTCCCCCGATCTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTTCCCACGCATTCAAACCGGATTCGGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCTTAAGCGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCTTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTGACGAAGTTAGAGACGCGATCCACAACCTCCAACCTAGGAAGGCACCAGGCTCCGACGGCATCCACAACCGCGCGCTAAAATTTTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGTATACATAAGCCGGGCAAACCGAGAAACGAAACTTCTAGTTACCGTCCGATTAGTCTCCTCTCGACGATAGGAAAAATTTACGAATGTCTCCTTAGGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCAAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATTCTGATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATCTACAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACTGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGACGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCATGGGACAGTGGTTCCGGAAGTGGCGAATAGACATCAACCCCACGAAAAGCGCAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAATATCACTTCGAGCATCCCACTCCGTAGTAGGCGCGCAAACACCTCCGCCGTTAGTCCCATCACTCTCTTTGGCCAGCCCATACCGTGGGTCTCGAAGGTCAAATATCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCATATAAAAACGGTACGCGACCGCGCCGCGTTTATTCTAGGACGACTCTATCCAATGCTTTGTAGTCGAAGCAAACTGTCCCTCCGCAATAAGGTAACTCTCTACAAAACTTGTATACGCCCCGTCATGACGTATGCAAGCGTAGTGTTCGCTCACTCAGCCCGCACCCACTTGAAATCCCTTCAGGTTATTCAATCACGATTCTGCAGGATAGCCGTCGGAGCGCCATGGTTCCTTAGGAATGTGGATCTCCACGATGACCTGGAGCTCGACTCTCTTAGGACCGCCACCGATGGCGGCAACCTCCTCCCAGTCAACCGCGCCGCGTTCGGGAGTGACGCAGGGACCGCCACCGATGGCGGCACCCTCCTCCCAAGTGGAAAAGTGTCCGGGAGTGCCGCGGGGCTCACAAGCGATGCCCCCTCCCGCCAAATATTGCCTACGCAATACTCGCCGGCGTCGCCAACGGGACCGAACAGCGGGGTCTGTCGTCGAGTGGTCAGACCTCCCAGCACCGCGACACCGGCAACAACTTCAGGCGACGCAGCAACGGAGAGCGTCGTATCCGCGAGCCAGAACAAGAAGGAGTCAGCGCTCGCGGCCAATCAAATAGTACACGGGTCCCACATCACGGACGCCGCTGCCAAAATCTCGACGACAGAAGAAGGTTCCACACTCCGCGACGGGATGGCGCCACCAGTACGAGGATCTTCGAGAAAGTCGAGTCAACAGTCACAACGGCTGTTGCTTATGGCGCGCCTCAAGGAAGAGCATCTTCGCGCCAAAGAAGAACAAGCCCGACTCCAAGCAGAGCTCGCCGCCGCCCGCATCTCAACATTAGAAGCCGAAGCGCTCGTTGAAGAGGAGGAAGATGCGCGCACAACACTCACGGAGGACGAGAACGAGCAATCACAGCGCATCGATACATGGCTCAGTCAGCAACGATCGATCGCGCTACAGGGAGTCGAAGAAAGAGTAATGCAGCCAACACATGGATCACCAGCCACCATCGAGCAACCGCAACTGGAACTTCCCGCACCAATAGAACAGCTGAAGCTACCGGCCCCTGCCGCGGCACCGATTGCCGCACCTGTCGCACCGAAGAGCGACATTGCCGAACTAGCAGCTGCCATCGCGACGGCCGCCCGCCAAGCCAGGCCCGGACCATCGCATCGGTACTACGGGGAGCTTCCAGTGTACAGTGGATCGCACCAGGAATGGCTCTCCTTCAAGGTCGCCTACGCCGAATCAGCGGACAGCTTCAGCGCCGCAGAGAATACTGCGAGACTTCGGCGTACGTTGAGAGGAAGAGCAAGAGAAGCGGTCGAAAACTTGTTGCTGCATTACACCGAGCCCGCCGAGATCATGCGAACTCTAGAATCGCGCTTCGGACGTCCAGAAGCAATCGCCGCAACGGAGCTGGAACGACTGCGCGCGCTGCCACGCTGCACGGACACACCGAGGGACATCTGCGTATTCGCGAATAAGGTGAACAACGTCGTCGCCGCTCTGAGGGCCCTCGACCGCGTACATTATATGTACAACCCGGAGCTCACCAACATCACATCGGAGAAGCTGCCGTCCACTCTACGCCACCGCTGGTTCGAATTCTCAGCGACTCAACCGGCGGGAGAACCGGACCTCGTCAAGCTGTCGCGCTTCTTACAGCGCGAGGCGGACCTGTGCAGCCCATACGCACAGCCGGAACCAGAGACGAGAGTGGAGAACACCAGCGGTCGGCGGAAGATGTTGAACATGCCTCAGAGGACGCACACCACGCAAGCAAAGGAAGAGAGGAAATGCGCAGCATGTCAGAAGCCGGGGCACATCCCACAAGATTGTCCCGAATTCAAGAGAGCAGCCGTCAGCGAGCGCTGGGATACGGCGAAGCGCGAGAATTTGTGTTTCCGGTGCCTACGGTTCCGGTCCCGGGGACACGTATGCAAAAAGAAGAAGTGCGGCGTCGACAGCTGCGAACGCACGCACCACGAGCTGTTGCATAAGAAGCCAGCATGGCAGAAGCCGAAAGAAAAAGAAGAGGCGGTCACCTCGACGTGGGCCGCAAGAAGTGCGACAGCCTACCTGAAGATGGCGCCAATTACTGTTATCGGACCGGCGGGAGAAGCAGATACATGGGCCCTGCTGGACGACGGGTCAACGATCTCGCTGATTGACGAAGACTTCGCGAGACGAGTGGGCGCCAAAGGACCGATCGAACCCCTCTTCATCACTGCCATCGGAGACAATAAGATAGACGCAACACGCTCACGACGCGTCCCGCTGAAGTTATGCGGACGCACGGGGGAACCGCAAGGACTGAACCTACGGACAGTCAACGGCTTAAAATTAACACCACAGCGACTGAACATCGAAGTCCTCGCGTCGTGCCATCACCTCACCGACCTCCGGCATCACTTCAAAACGAGCTACGCCTCGCCGAAGATCCTGATCGGCCAAGACAACTGGCACCTGCTGGTGACGGAGGAGATGCGGACGGGACGACGCGATCAGCCAGTGGCGTCTCGTACTCCGCTCGGGTGGGTCGTGCACGGAGCACACCCGGGAGGCAAGAGACAGCGCGTCAACTTCGTGGCACACGCGACGACGGCCGACGCGAACATGGACGAAGCCCTCAGGCACTACTTCGCGATCGAGGGACTCACCGTCGCCGCCAAGACGCCGAAGAATGACCCAGACGAGCGCGCGCTGAAGATCCTGCGAGAGACCACTCAACAGCGACCCGACGGCCGCTACGAGACCGCACTGCTGTGGCGTGAGGAGGGCCTGAAGATGCCCAACAATTTTGAAGCCGCGCTGAATCGCCTGACGTCCGTAGAGAAGAAACTGGAGAAGGATCCAAATTTGAAAGAGCGCTACAAGCGACAAATGGACGCACTGGTAGCGAAAGGATACGCCGAAGTAGCTCCGTCAACGGGGACGAAGGACCGAACCTGGTACCTACCACACTTCGGCGTAACACATCCGATGAAGCCGGACAAGATTCGCATCGTGCACGATGCCGCTGCGAAGACCAGGGGGAAGAGCCTCAACGACTTCCTGCTCACCGGCCCGGACCTGCTGCAGTCGCTGCCCGGAGTGATGATGCGCTTCAGGCAGCACGCCGTCGCCGTCTCAGCGGACATCACAGAGATGTTCATGCAAATAGGCGTCCGAAGCGAGGACCGCGACGCGCTCCGGTACTTGTGGAGGGAGGACCCTTCACAGGAGCCTACAGAGTACCGGATGAAATCTATAATCTTTGGCGCGACAAGCTCACCCGCGACCGCCACCTACGTGAAGAACGCCAACGCGGAGAAGTACCGACTGCAGTACCCGGACGCCGCCGACGCAATCGTACGCAACCACTATATGGACGATTACCTGGGAAGTTACCGGACAAGCGAAGACGCGATCAGGATCGCAAATGAGAGAAGTCTTGGAGAGCAGCGCGCCTACGAAGAGACAGGCTCTGCGAATTATGATGTCCGTCTACGATCCCCAAGGCATCGCATCACCAGTCACTGTCGGAGCGAAGAAGATCCTCCAAGAAACGTGGCGCCGAGGGACGGCGTGGGACTCCCCCTCGATGAAGACCTCTGCGCGATGTGGAGAGAGTGGATCGACCACTTAAGACGCCTGCGCGGCGTCTCAGTGCCGCGCTGCTATCCCGGCTACTCAGACGCCGCCAACCTCCAGCTCCACACATACGTAGACGCCAGTGAGTCCGCCTACGCCGCCGCGTTATACTGGCGCGCCGAAATGCCCGACGGGGAGATCAGGACCTCCCTCGTACTCGCCAAAGCCCGAGTCGCGCCCTTGAAACTCACCTCGATACCGCGCCTCGAGCTACAAGCTGCCGTGATGGGCAGCCGCATGGCCGCGGCTGTCACAGAGGAACACGACAGAAAACCAGACGCGAGAGTGTTCTGGACAGACAGCGCCACCGTATTGACCTGGCTACGAACGGGGTCGAGGTCGTATCGACCGTTCGTCGCTCACCGCATTGCAGCGGTAGAAGAGAACAGCACTGTGGAGGAATGGCGCTGGGTCCCCACGAAGGAAAATGTCGCCGACGACGCCACTAGAGAGCTACCCGTCGGCTTTGAAAGAAACCACCGCTGGTTCATAGGCCCGGAATACCTAAGACGGCATCCGGATGATTGGCCCGTACAACGGACTGCAAGAAGGGCAGAAGAGACGGGTGAAGAGAAGTGCGCAACGCTCGCCGTGAGCAGAGAGAGCCTCGGCGAAGCAATCCCGGACCCGAGACGCTTCTCCAAGTGGGAGAAGTACCTGCGTGCAACGGGGCGAATACTGCAATTCGTCGACCTATGCCGCAGAAGTCGCGAGCGCACTCATTACAAGAGGACCAGGCGGAACCCGCGTTCGGACCCGACGTGGGAGAAGAATAGAAAGAAGACGACTTCGAAGACCCCGCTGAACACACCGCGGACGCCAGAGCAAGCAGTCATTCAATGGAAGACTTTAGACGCCGACACGCTTCGACGCGCCGAGACGCTCATTTGGCGACAGAGCCAGCGGGCGGCCTTCGAGGAAGAGATTTTGACGCTCCAGCGAGGGAAACAGATATCCCCAGCGAGCCGACTGCGAAACTTGTCCGTAACTTACGCGGACGGGATATTGAGAATAAACGGACGCATCGGCAACATAGAGGGAGCTGACGTCATCACCTCGCCTCTCGTGCTAGACGGATCCCGACGCGAAACGAGACTGATGATAGACTTCATCCATAGAAAGATGCACCACGCCGGAACCGAAGCTACGATCGCCGAGTGCCGACAGTCGTACTGGGTCTTACGCCTACGCCCAGTGACACGGAGCGTGATCCACAACTGTCTTCCGTGTCGTATCCGCAAGGACACTCCACCGCGTCCAGCCACAGGCGACCACCCACCGAGCAGACTGGCACACCATCGGCGACCATTTACATACGTGGGCCTCGATTACTTCGGGCCCTATCAAGTGACCACCGGCAGAAGCACCCAGAAGCACTACGTGGCCATCTTCACATGTCTCACTACGCGTGCGGTACATTTAGAACCGGCAGCGAGCCTCAGCACGGACTCAGCGGTGATGGCACTCCGGCGCATGATCGCGCGCCGGGGAGCCCCGACGGAGATATGGAGCGACAACGGCACCAATTTACGGGGTGCCGACAAGGAGCTGCGCCAAGCTTTGGACAAGGCGACTGAGCATGAAGCGAGCTTAAGGCTTATACAATGGCGCTTCATCCCACCGGGCGCGCCTTTCATGGGCGGCGCCTGGGAGAGAATGGTGCGGGCGGTAAAGGCCGCGCTCTCGGCCACGGAACAGCCGAGGCACCCGACGCCCGAAATATTTCATACTCTGCTAGCGGAGGCAGAGTTCACAGTGAACAGCCGACCTCTCACTCACGTATCGGTGAGCGCCGACGATCCCGACCCTCTGACACCGAACCACTTCCTGCTGGGAGGCCCGGCGCGAGTCCCCGTGCCGGGCAAATTTGACGACGCCGACCTCGTAGGGCGCGCACACTGGCGCGCAGCACAACGTCTGGCAGATGTGTTCTGGAGTCGCTGGCTCCGGGAGTACCTGCCCGACCTGCAGAACCGGCGGGAGCCCCACAGCCGCGGGCCCGCCCTGAAGATAGGCGACGTCGTGATAATAGCAGACGGAACGCTCCCACGCAACACCTGGCCACGTGGGATCATCCAGGAGGTTTACCCAGGGGCCGACGGCATCACTCGAGTGGTCGACGTGCGCACCGCCGGCGGTATCCTGCGACGCCCGGCAAAGAAGATCATCGTGCTGCCCACGATGTCAGCCGCTCACCAAGGAGGATGCAGCGACGTGAACGACGCTGCACGGCGGGAGGATGTTCGCGACGGACATGAATAA
Protein
MEEISESVISDSDFVGFLRERYPTIRAEYVRYRASRGNPSPPGSVAAFLNRASEARRAPPAAALSSSARSDDAAHIAPNATPTPAPASFTSSRSSSVATSIVSSSGSDTESEMDFESASSPQPGTSDGFQTVTRGKKRSRAVESRSSTTKQTKSATASRPQVVVTPESDSARRVTPPPRPKPAPAPKVAAPPPLILQEKTAWNRVSQALQANKINYTHARNVAHGIQIKVATPGDHRALSSYLRKENIGFHTYALQEDRELRVVIRGVPKELDIDYIKEDLTAQSLPLVSVHRMHSGRGKQPYNMILVALEPTPEAKKKIACLTTICGLSGISIEAPHKRGTPGQCYRCQLYGHSARNCHARPRCVKCLGDHATLDCVRDRETATEPPSCVLCLKQGHPANYRGCPRAPRKRSTLPAPRTVGPKTSAPSVPKPAFVPAAVPTVSAWKKPLPYTKAGTQTAPPPPLATRPAPQPLLAPRPAPAFRPPQPSAANDFALVRDFVTAVNFDRLRSFADAIRRSTTPEQRLAAAFDHMDVYESVSPFYNANGLARQRDQIFEFLRDNLIDILLVQETCLKPSRRDPKVANYVMVRNDRLTASKGGTAIYYRRALHVVPLDTPSLLHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIVGPPTPTCYPYNIALRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPHNPVTVTRTMVDWNKLGTCLADAAPPILPCGPDSNPSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSPDLRNLLRVRNAAIRAYDRLPTHSNRIRMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLLRPSGQPPAFDDDDKAELLADALQEQCTTSTQHADPEHTELVDREVERRASLPPSDALPPITTDEVRDAIHNLQPRKAPGSDGIHNRALKFLPVQLIAMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPRNETSSYRPISLLSTIGKIYECLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATMGQWFRKWRIDINPTKSAAVLFKRGRPPNITSSIPLRSRRANTSAVSPITLFGQPIPWVSKVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCSRSKLSLRNKVTLYKTCIRPVMTYASVVFAHSARTHLKSLQVIQSRFCRIAVGAPWFLRNVDLHDDLELDSLRTATDGGNLLPVNRAAFGSDAGTATDGGTLLPSGKVSGSAAGLTSDAPSRQILPTQYSPASPTGPNSGVCRRVVRPPSTATPATTSGDAATESVVSASQNKKESALAANQIVHGSHITDAAAKISTTEEGSTLRDGMAPPVRGSSRKSSQQSQRLLLMARLKEEHLRAKEEQARLQAELAAARISTLEAEALVEEEEDARTTLTEDENEQSQRIDTWLSQQRSIALQGVEERVMQPTHGSPATIEQPQLELPAPIEQLKLPAPAAAPIAAPVAPKSDIAELAAAIATAARQARPGPSHRYYGELPVYSGSHQEWLSFKVAYAESADSFSAAENTARLRRTLRGRAREAVENLLLHYTEPAEIMRTLESRFGRPEAIAATELERLRALPRCTDTPRDICVFANKVNNVVAALRALDRVHYMYNPELTNITSEKLPSTLRHRWFEFSATQPAGEPDLVKLSRFLQREADLCSPYAQPEPETRVENTSGRRKMLNMPQRTHTTQAKEERKCAACQKPGHIPQDCPEFKRAAVSERWDTAKRENLCFRCLRFRSRGHVCKKKKCGVDSCERTHHELLHKKPAWQKPKEKEEAVTSTWAARSATAYLKMAPITVIGPAGEADTWALLDDGSTISLIDEDFARRVGAKGPIEPLFITAIGDNKIDATRSRRVPLKLCGRTGEPQGLNLRTVNGLKLTPQRLNIEVLASCHHLTDLRHHFKTSYASPKILIGQDNWHLLVTEEMRTGRRDQPVASRTPLGWVVHGAHPGGKRQRVNFVAHATTADANMDEALRHYFAIEGLTVAAKTPKNDPDERALKILRETTQQRPDGRYETALLWREEGLKMPNNFEAALNRLTSVEKKLEKDPNLKERYKRQMDALVAKGYAEVAPSTGTKDRTWYLPHFGVTHPMKPDKIRIVHDAAAKTRGKSLNDFLLTGPDLLQSLPGVMMRFRQHAVAVSADITEMFMQIGVRSEDRDALRYLWREDPSQEPTEYRMKSIIFGATSSPATATYVKNANAEKYRLQYPDAADAIVRNHYMDDYLGSYRTSEDAIRIANERSLGEQRAYEETGSANYDVRLRSPRHRITSHCRSEEDPPRNVAPRDGVGLPLDEDLCAMWREWIDHLRRLRGVSVPRCYPGYSDAANLQLHTYVDASESAYAAALYWRAEMPDGEIRTSLVLAKARVAPLKLTSIPRLELQAAVMGSRMAAAVTEEHDRKPDARVFWTDSATVLTWLRTGSRSYRPFVAHRIAAVEENSTVEEWRWVPTKENVADDATRELPVGFERNHRWFIGPEYLRRHPDDWPVQRTARRAEETGEEKCATLAVSRESLGEAIPDPRRFSKWEKYLRATGRILQFVDLCRRSRERTHYKRTRRNPRSDPTWEKNRKKTTSKTPLNTPRTPEQAVIQWKTLDADTLRRAETLIWRQSQRAAFEEEILTLQRGKQISPASRLRNLSVTYADGILRINGRIGNIEGADVITSPLVLDGSRRETRLMIDFIHRKMHHAGTEATIAECRQSYWVLRLRPVTRSVIHNCLPCRIRKDTPPRPATGDHPPSRLAHHRRPFTYVGLDYFGPYQVTTGRSTQKHYVAIFTCLTTRAVHLEPAASLSTDSAVMALRRMIARRGAPTEIWSDNGTNLRGADKELRQALDKATEHEASLRLIQWRFIPPGAPFMGGAWERMVRAVKAALSATEQPRHPTPEIFHTLLAEAEFTVNSRPLTHVSVSADDPDPLTPNHFLLGGPARVPVPGKFDDADLVGRAHWRAAQRLADVFWSRWLREYLPDLQNRREPHSRGPALKIGDVVIIADGTLPRNTWPRGIIQEVYPGADGITRVVDVRTAGGILRRPAKKIIVLPTMSAAHQGGCSDVNDAARREDVRDGHE

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.00783066,     Score=101

Ontologies

Topology

Length:
3276
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0586500000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  3276
 
 

Population Genetic Test Statistics

Pi
27.766067
Theta
172.440005
Tajima's D
0
CLR
325.833568
CSRT
0.369531523423829
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号