SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO13269
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 3.139
 

Sequence

CDS
ATGGACGAACTATACGTCCGTCGCCCAATCCCACGAGCCCGACCGGTCCCGATGGACCCCGGCAAGGACGATTCGGCCGGTCCTTCGGTCCCGGCCCGGGTCTCCCAGGGGATCGGACCGGGGGAAGGTTTCCTTCCCTTGTCGACCGATTACCCTGGGACTCCTCGGCCGAGAAAGAAGGCCAGGTCTGAGTCCGACCGAGGTTCATCGGAGGACCAAGACAAACGACCGCGACTAGGTCCCTCCTCTAAATCGGAAGGAGAGGATAGCGAGGCCACGTCCTCCTCCCCCTCCTCCTCCCAATCTTCCACTCCAGACTCATCTCGATCCTCATCCCCTACTGGGAGTCCCATCCCAGCAGTCAAACCTGTTCCCAAACCGAGGGCCCCCGTCAGGACAGGGGTAGCCCCACGCCTACTTAGATCCCCTCCCCGATCCCCCTCCCCTACCATTTCCCCTATCCCGGTGGATTCGACTCGAGGTGCCCCCGCCCTAAGCGGCACGGCGGGCAATCTGGACTCTACCAGATATATGGACCTCGAGTCCACCAAAGCCCAACAACCCATCCCCTCTACGTCCTACGCGACCATAGCCGCATCTCAACCCCCAGTGGGCACACGCCCCAAGCCTACCCAACCGCAAGTTCCCCTACCCCCGAGGCCGAGGGGTCGGGCCCAGGAGGAGCTCCGCCGTCATCCACCTATCATGGTGGAAGCTCTCCCGAACTGGTCTCGCCATATGGCGGCCATTAGGGAGCGCCTCGGTAGGGCTCCTTCTGCCAGACCCCACGGCGCCGGTTTCCGCTTCCTGCCGTCATCGGCGGAGGAGTACAGGGTGATCCAGGACTATCTTTCAAGGGCCTCCGCTGCAGACAAAACCATCAAATGGTTTTGTTACGCGCTGTCGGAGGAAATACCCTCGAAGGTGGCTGTCCGGGGTCTCCCTGCTGACACCGATGCGGCGGAAGTAACGAACGCCCTCAAGGAGCTGGGCTTTCCTGCCCGATATGCCCGGTGCATCCAGGCCAAGAGGGGGAGACAGGGCTGCGTATTTTTCGTGGCTCTGGACCACCTCTCCAAGGGTGACCTCGCCCGGCTGTATACAGTTAACGAACTGTTATACTTGCCGGGGGTGACGGTCGAGGGATGGCGTCCAACCCGGGGACCTGCGCAGTGTCACCGCTGCCAGGCCTTCGGGCACGCGTCCACGAACTGTCACCGTGCGGTCCGCTGCGTTCGATGTGCCGGCGAGCACATTGTGGCGGACTGCCCGAGGCCAAGGGATGGCCCATTATCCTGCGCTAATTGCGGGAAGGACCACGCCGCCACTGATCGGCGGTGTGTGGTCTACCGCAAGAGGGCCAGGATGATGGGAGTAACCATCCCCCCTCCTGTTCCACCGGTGCCACGGCCCAGGAATGTCCCAGCACCAACTGCTCCTGTCGTGCCTGTACCTGTACCCATCCTCAAGGGGAAGGGGAAGGGGAAAGGGAAATCTTCCCAAACCCCAGCCCCTCCCCCTCCTAGTACCTTCCCGTCTGTCTCGGTAGTGGAGGCAGCACCGTCAGCGTCCACGCTGATGGCGCAGGCCAACCCGCCGCGACAGACTAAAAAGCCCACTCCTACTCCTCGTGGCCGAGCCCAAATTGAAGCTGTCAATACAGCCCACGTCACTCGCCAGACAGCAGGCCCAGCCACTAAGACGTCAAAAAATAAAAATAAAAATAAAAAAAAGAAAGAGAAGAAAAAGCTCAAAAAGAAATTGGCGAGAGAGCTCAGTGTCGCCAATATGGAAGTCGACCAACAACCTCAGGAGGCCATAGAGGCCAACGTAACCGAAGACACCATCCCTCCACAATTGGAGGGTCAAACCATGCCTCAAGCCCAACCCGAGACGTTGGGCAATACTCTGCCCCCTCTTCCTCCCCGCCCTCAGCGCGAGCAGCGCAGCGGTCGGCAGGCCTCACAACCTGCCGGCTTTGCTGCATGGCTCCTCGCGCTCTGGGAGAAATTGTCCGAGGTGGTCTCCGGAGTGATCCGCGAGATCGCCTCGGGAGCCAGCCCTTTCGGGGCTCTCTTGTCGGGGCGAGACGTGGTACATGATCAGTTGGATTTGCTGGCCTTCACATCGACAAGGTCGATCGGTGTGAGGATCCACACCTCGGGGGGAGATATGCGGGTTTATGCCGCGTATAGACCCCCGGGGCCTGATTTTCATCCCGGGGACATAAGAAGGGTCCTGAGTTGCGACAGCCGCCCAGCTCTGCTGGTCGGGGACCTCAACGCGAAGCACGTCGCGTGGGGCTCCCGACTGAACTCAGCAGTGGGCAGGCGGCTGTTAGAAGATGCCGATAGGGGCGACTACTCTGTGGTCGGCCCCGACGAACCCACGCACATTCCGACCGCCGCGCAACTCCAGCCCGACGTGTTGGATGTGTGCGTTCACAAGGGGCTACGGTGCCCCTTAACTATTGAGGCACTGTACGACCTGGGTACCCCCCATCTCCCTATCCTGGTGACACTGGGAATGGGGCTTACCCGGGTTGCGACCTCGCCCCTACGACCGAAGGTCGACTGGGAGCTCTTTAAGAGACTCCTAGTCGACCTTCCCGTAATTCAGGACCCCAACACCCCTGAGGGGGTCGACGACGCGGCAGTCCGCCTTGTCGACTCCATCAGGGGAGCGATCGACCAGGCGACGACTCTTGTGCCCAGCGGCGGGCCCAGAGGTATACTCCCGGCCCATCTGAAAGCGATTATTCGCCGGAAGAGGGGCCTGAGGAGGCTCTGGGCGACAACTCGTTGTCCCAGGATCAAGCGCGAGCTTAATGAGCTGGAAGCGGAGTTGGCGGCGAAGATTAGCTCCTATCGGGGCTATGCGTGGGAGGAACGGATCGAGGAGGCCCGTGAGGACCCCTCGTCCGTGTCCCTCCACCGACTTTGCCGCCAGCTCTCAAATCGGCCTGCCCCGACTTGTCCACTCGTGGACGAGAGGGGCAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATGTCCTGGCCGTAATGCTGGAGCGGCAGTTCGCTCCAAATAACTCTGCACCCTCAGAGGCCGCATTCCACCAATCGGTGGAAGAGAGCGTAGCAAGCCTACTCTCCTCCCCGGTGCCACCGTTGGGAGATGGTGATTTCATCACTCCCAGTGAATTGCGCCTCTCCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGCGAGGACGGTATTCCCTCCCTCGCATTTTTCCACTTCCCCGAAACGGTCGTGTCATTCATGACACGACTGTTCAATTCCATTCTGTCCACAGGACACTTCCCGGGAACTTGGAAATTGGGCAAGGTTATTGCCCTGCCCAAACCCGGCAAGGATAGGAGAAATCCCTCCAGTTATCGTCCGATCACTCTGCTGTCGCATATGGGCAAGTTGTTCGAGCGGCTGCTGCTGAGAAGGGTGTCGCCGCACATCCTTCTCAGACCCGAGCAATTCGGGTTTCGCAGCGGTCACTCGACAACGCTGCAATTGGTCCGCGTTATGCACCACTTGGCGGATCGGCCCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGATATCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGATCTACAAGCTGTTGCAGAACACGGACCTCCAGCACGCCTATGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCCTTGTCGCGGTCGAGGGCGCAAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCCCAGGGAAGCGTCCTGGCACCAGTCCTCTACGCTCTCTACACCAACGACATTCCCACGCTTGAGGGCAACCTCCAAGCGTGGGAAGCCGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCTCGTCCTCTAATTTCCCCTCTGCGGCCATTTCGAGGATGCAGAGGCTGTTGGACCTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACCGCGGCTATCCTCTTCGGTCCGGTCCGCACAAGAGCCGTCCCAGGACAGCTCAGTCTCCGTGGAGTCAATGTCGAGTTTAGGCCCAGTGTCCGATACCTGGGAGTCAGTATCGACCGGAGTTTGAGGATGACCGCCCACGCCAAGTCGGCGTTGGCGGCCGCCCGCTATGCGAGGTTTCTCCTCCGGCCGGTGTTGGCCTCCAGGTTGCCGACCAGGACTAGACTCGGCATTTACAAGACGTATGTCCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGATCATGCGGGTGAAGTTACAGGCCCAGCAGAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGAAATGACGTAATCGCCCGGGATCTAGATGTGGAGTCGCTCGAGGAGTTCATTCGGAGGCTAGCTCGTAATATATACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTCAGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGGTAAGATAG
Protein
MDELYVRRPIPRARPVPMDPGKDDSAGPSVPARVSQGIGPGEGFLPLSTDYPGTPRPRKKARSESDRGSSEDQDKRPRLGPSSKSEGEDSEATSSSPSSSQSSTPDSSRSSSPTGSPIPAVKPVPKPRAPVRTGVAPRLLRSPPRSPSPTISPIPVDSTRGAPALSGTAGNLDSTRYMDLESTKAQQPIPSTSYATIAASQPPVGTRPKPTQPQVPLPPRPRGRAQEELRRHPPIMVEALPNWSRHMAAIRERLGRAPSARPHGAGFRFLPSSAEEYRVIQDYLSRASAADKTIKWFCYALSEEIPSKVAVRGLPADTDAAEVTNALKELGFPARYARCIQAKRGRQGCVFFVALDHLSKGDLARLYTVNELLYLPGVTVEGWRPTRGPAQCHRCQAFGHASTNCHRAVRCVRCAGEHIVADCPRPRDGPLSCANCGKDHAATDRRCVVYRKRARMMGVTIPPPVPPVPRPRNVPAPTAPVVPVPVPILKGKGKGKGKSSQTPAPPPPSTFPSVSVVEAAPSASTLMAQANPPRQTKKPTPTPRGRAQIEAVNTAHVTRQTAGPATKTSKNKNKNKKKKEKKKLKKKLARELSVANMEVDQQPQEAIEANVTEDTIPPQLEGQTMPQAQPETLGNTLPPLPPRPQREQRSGRQASQPAGFAAWLLALWEKLSEVVSGVIREIASGASPFGALLSGRDVVHDQLDLLAFTSTRSIGVRIHTSGGDMRVYAAYRPPGPDFHPGDIRRVLSCDSRPALLVGDLNAKHVAWGSRLNSAVGRRLLEDADRGDYSVVGPDEPTHIPTAAQLQPDVLDVCVHKGLRCPLTIEALYDLGTPHLPILVTLGMGLTRVATSPLRPKVDWELFKRLLVDLPVIQDPNTPEGVDDAAVRLVDSIRGAIDQATTLVPSGGPRGILPAHLKAIIRRKRGLRRLWATTRCPRIKRELNELEAELAAKISSYRGYAWEERIEEAREDPSSVSLHRLCRQLSNRPAPTCPLVDERGNRCFSAQARADVLAVMLERQFAPNNSAPSEAAFHQSVEESVASLLSSPVPPLGDGDFITPSELRLSIKRMKRRKAPGEDGIPSLAFFHFPETVVSFMTRLFNSILSTGHFPGTWKLGKVIALPKPGKDRRNPSSYRPITLLSHMGKLFERLLLRRVSPHILLRPEQFGFRSGHSTTLQLVRVMHHLADRPNARQYTAAVFLDIEKAFDRVWHAGLIYKLLQNTDLQHAYVRLLGSYLEGRSFLVAVEGAKSSVRPVTAGVPQGSVLAPVLYALYTNDIPTLEGNLQAWEADVKLALFADDSAYFSSSNFPSAAISRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTRAVPGQLSLRGVNVEFRPSVRYLGVSIDRSLRMTAHAKSALAAARYARFLLRPVLASRLPTRTRLGIYKTYVRSRITYAAAAWYHLIPQIMRVKLQAQQNLALRTIVGAGRYVRNDVIARDLDVESLEEFIRRLARNIYERADGGPHEHLHNIAPLHARPPDGQALPRELLEPPAMVR

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.000200942,     Score=112

Ontologies

Topology

Length:
1527
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02812
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  1527
 
 

Population Genetic Test Statistics

Pi
218.615953
Theta
155.633728
Tajima's D
0.971653
CLR
216.994429
CSRT
0.649067546622669
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号