SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12727
Pre Gene Modal
BGIBMGA007189
Annotation
PREDICTED:_zinc_finger_protein_845-like_[Plutella_xylostella]
Transcription factor
Location in the cell
Nuclear   Reliability : 4.739
 

Sequence

CDS
ATGTACAGTCTACAGTCTAATCCATTACAAACTTATTTTGAAGAAACATTAGGAGTTAATCCTGTCTGTTCTATGGATTTGCCGCAGTGTGTGTGTTATGTATGTGCAGCATTATTGCAAAAATATAGTAGGTTCAAAACTAAGTGCTTACTTGGACAATCTGTGCTCTACCAAATACTAAACTCTGGTAAAAAGATTACAATCACATCAGTCCAAGAACTAGACCGAAGCAATTTAAAAACACCATTCGCCGTGTACACTGAAACAGATGTTAAAACAATTCACACAGTTTCCGACGATCCGAAGCTTCCAATTAAAGAAGAAATAGACATAGCGATAGATAGTAAAACATCATTAGAAAATGACCTGCAAGTGAATGAAATATTTCGTAAGGATGGCGAGTATGTGAAAGATGAGGATTACGGTGATTTCCCTTCTCAGCTAGAAGAGACAAGCGACGACGAACCGCTTTTAATGCACAAAATAAAGAAAGCTAAGAAAGCCAAAAAGAAAACGACCAAAAAGGATAAGAATAAAGTTGATTATATTTTGGCTGAAGACTTTCAAGGTGTCGAAGCAACAGACGATTCTTCGGCGTTACCACCAGAGATAACAGAAGTTTTACAGTCCAGAAAGAGAGGTCGACCAAGTAAAAAGAGAGTACAGGCAGAACCTGCGGGAAAGAAACGTAGAAGAACGAAAAATACGGGTGGGGTCACTGAAGACGATATTGTCTTGGAGGAATGTTGTACAATAACAACATTGAGTCAAGAAGAACAGCTGGAGGAGATCAACAAGCGGCAGTACTCCAGCAACTACATGAACGCTCAGTACAAGTGCCAGCTCTGTTACAAGGGCTTCATAGACACAGAGGCCTGGAGACATCACGTCTCCAAGCACTCACCCAGCGCGGGTGCAATAGAGTGTCCAGTGTGCAAGTTCCGCTTCGAGAACAAACGCCAGTTCCAGAAGCACGCCTCCAACCACGAGAAGAAGTACGCCTGCAACTACTGCGACCACGTCTCCGCCACGACAACCCAAGCGAAGCAGCACCAGCGCTGGCACAGGGGCGTCACGTACAAGTGCCAACACTGCGACGAGGTGTCCACCAAGTGGACGTCGTACCTGAGCCACGTACGCATGAAGCACCCCTCGGAGTTTATATGCGGCGCGTGCGGCTCCTCCTTCGTGAGCCGCCTGGGGCTGGCCATGCATAAGACCATGATGCACAAGGACCTGGATGAGAAGTCCGAAGCGGGCCCGTACTGCGCGGAGTGCGACGTCCAGTTCGCGTCGCTGGAGGCCTACAAGAGGCACATGGTCACGTCCGTCAAGCACGCCGAGCTCACGCTCACCAACAACGGCTGCCGGGTGTGCGGCGAGACGTTCGGCAGCGGGCACGAGCTGCGTGCGCACGCGCGGCGCCACCACGCCAAGAAGCGCCCCAAGAACTACGGGAAGAAGCCCACCAACCTCACTTGGCCCCTCAAGTGCGATCAGTGCTCACAAGAGGTGCATAGCGCGCGCGAGTACTGGAACCACTTCCGGCGGACCCATCCCGACAAGCCCTACCCCATTCAGAAGGACCACATCTGCGACGTGTGCGGAAAGAGCTTTAGGGGCAACGCGTTCCTGACGTACCACAAGCGCACCCACTCGGAGGAGCGGCAGTTCAAGTGCGAGACGTGCGGGAAGGCGTTCCACAACCCCGGCAACCTGTACATGCACGAGAAGATACACTCCGACCTCAGGCCCTACTCCTGCTCCGTCTGCTTCAAGGCCTTCAAGGGGAAGGGCGGACTCAGCAGACATTTTAGGTGTCACACCGGGGAGAGGCCTTACGATTGCGAGATCTGCGGCAAGGCGTTCAGTCAGTCGAACAGCCTCAAGGTGCACGTGCGCACGGTGCACTTAAAGCAGCCCGCGCCGTACGTCAGCCGCACCCGCCTGGAGAGGCGCCTCAAGGCCGGCACGGGCAAGGACAAACCTCACGAACCCTTCGCTTACACGTGA
Protein
MYSLQSNPLQTYFEETLGVNPVCSMDLPQCVCYVCAALLQKYSRFKTKCLLGQSVLYQILNSGKKITITSVQELDRSNLKTPFAVYTETDVKTIHTVSDDPKLPIKEEIDIAIDSKTSLENDLQVNEIFRKDGEYVKDEDYGDFPSQLEETSDDEPLLMHKIKKAKKAKKKTTKKDKNKVDYILAEDFQGVEATDDSSALPPEITEVLQSRKRGRPSKKRVQAEPAGKKRRRTKNTGGVTEDDIVLEECCTITTLSQEEQLEEINKRQYSSNYMNAQYKCQLCYKGFIDTEAWRHHVSKHSPSAGAIECPVCKFRFENKRQFQKHASNHEKKYACNYCDHVSATTTQAKQHQRWHRGVTYKCQHCDEVSTKWTSYLSHVRMKHPSEFICGACGSSFVSRLGLAMHKTMMHKDLDEKSEAGPYCAECDVQFASLEAYKRHMVTSVKHAELTLTNNGCRVCGETFGSGHELRAHARRHHAKKRPKNYGKKPTNLTWPLKCDQCSQEVHSAREYWNHFRRTHPDKPYPIQKDHICDVCGKSFRGNAFLTYHKRTHSEERQFKCETCGKAFHNPGNLYMHEKIHSDLRPYSCSVCFKAFKGKGGLSRHFRCHTGERPYDCEICGKAFSQSNSLKVHVRTVHLKQPAPYVSRTRLERRLKAGTGKDKPHEPFAYT

Summary

Pfam
PF00096   zf-C2H2        + More
PF07776   zf-AD
PF05485   THAP
Interpro
IPR036236   Znf_C2H2_sf        + More
IPR013087   Znf_C2H2_type       
IPR012934   Znf_AD       
IPR006612   THAP_Znf       
IPR038441   THAP_Znf_sf       
SUPFAM
SSF57667   SSF57667       
Gene 3D
PDB
5V3M     E-value=1.39505e-25,     Score=291

Ontologies

Topology

Length:
670
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01281
Exp number, first 60 AAs:
0.00629
Total prob of N-in:
0.00045
outside
1  -  670
 
 

Population Genetic Test Statistics

Pi
21.508726
Theta
20.077289
Tajima's D
0.072183
CLR
0.769671
CSRT
0.396830158492075
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号