SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12718
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon X-element      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.708
 

Sequence

CDS
ATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGTATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCATCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGTCCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAAGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAACCTAA
Protein
MVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSIPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKVLRPRKAPGSDGISNRVIKLLPVQLIVMLAFSMPLWRTVSFPRCGKKRTLSAYINPVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHARASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPGNRTRRTRQRGRRAT

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon X-element
EC Number
2.7.7.49
EMBL
AB055391    BAB21761.1    KQ459265    KPJ02064.1    AF081103    AAC72921.1    + More
GEZM01008457    JAV94772.1    GALX01005299    JAB63167.1    KQ973342    KXZ75569.1    KQ971729    KYB24751.1    GALX01005359    JAB63107.1    GBBI01004395    JAC14317.1    ABLF02042518    ABLF02057746    GGMS01006359    MBY75562.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GGMR01018716    MBY31335.1    GBBI01004571    JAC14141.1    ABLF02022418    GFTR01008262    JAW08164.1    ABLF02037436    ABLF02041767    NEVH01011985    PNF31054.1    NEVH01022639    PNF18527.1    ABLF02023911    GFTR01008038    JAW08388.1    ABLF02034467    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    NEVH01021205    PNF19912.1    GFTR01008279    JAW08147.1    GGMS01002992    MBY72195.1    GEZM01053022    JAV74219.1    GBGD01000415    JAC88474.1    LBMM01013518    KMQ85605.1    ABLF02024246    NEVH01006736    PNF36716.1    ABLF02028535    ABLF02028545    GGMR01016905    MBY29524.1    GGMR01003407    MBY16026.1    ABLF02025082    ABLF02039175    ABLF02041809    GGMR01000226    MBY12845.1    KK119692    KFM76444.1    GEZM01084969    JAV60363.1    S59870    AAB26437.2    NEVH01017470    PNF24199.1    GGMS01017365    MBY86568.1    GGMR01000676    MBY13295.1    RPOV01000134    RPJ78669.1    ABLF02029306    ABLF02029314    ABLF02060138    GFTR01008251    JAW08175.1    NEVH01020940    PNF20481.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GFTR01008256    JAW08170.1    GGMR01003864    MBY16483.1    NEVH01026386    PNF14434.1    GFTR01008151    JAW08275.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    NEVH01016302    PNF25823.1    GECL01003538    JAP02586.1    ABLF02014118    ABLF02014121    ABLF02054790    GGFJ01001858    MBW50999.1    GGFJ01001857    MBW50998.1    DNOY01000259    HBE18313.1    GGMR01016296    MBY28915.1    GGFJ01001822    MBW50963.1    GGMR01006408    MBY19027.1    NWSH01000032    PCG80496.1    GFTR01008246    JAW08180.1    GBGD01000389    JAC88500.1    KU543685    AMS38375.1    NEVH01005295    PNF38784.1    GGMS01000737    MBY69940.1    GGMR01004661    MBY17280.1    AF456125    AAL57609.1    AY180919    AAN87272.1    GFXV01007093    MBW18898.1    NEVH01007402    PNF35856.1    NEVH01016340    PNF25410.1    NEVH01021925    PNF19341.1    CP012527    ALC48130.1    AF237761    AAF81411.1    NEVH01001347    PNF42959.1    NEVH01019963    PNF22185.1    NEVH01008277    PNF34262.1    NEVH01007838    PNF34986.1    NEVH01015305    PNF27092.1    NEVH01014858    PNF27387.1    NEVH01002716    PNF41415.1    NEVH01023979    PNF17579.1    ABLF02017815   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
841
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.3774
Exp number, first 60 AAs:
0.05507
Total prob of N-in:
0.01469
outside
1  -  841
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
3.335234
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号