SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12700
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Full name
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.82
 

Sequence

CDS
ATGTCTGGGGGAAATTCACCCCCGCTCATCAGCACTCCCGGCCCGTCTCACAAGGGACGACAGGTGATGCCTCAATCAAGCAGATACCAACCAACGCCAGCAGCTCGCATAGGCTCGATGGGACTCGGGACGGACAGTCTGCCCGGGCCTTCGGTCGCGGCCCAGAGGACTCTGAGGATCGAACCGGAGGAAGATAACCTTCCTTCGTTGACCGATCCCTCTGGGCCCTCTCGGCCGCGGAAGAAGGCCAGGTCCGAGTCTGACCGAGGCTCATCGAGCGATAAGGACAAGCGTCCCAGACTAGGCCCTTCCTCCAGATCGGAGGGGGAGGATAGTTCGACCACGTCCTCGGCTCATTCCTCGACAGAATCAGTCACTCCCTCCTCGTCCAGATCTTCGTCCCCCTCTGGGAGTCCAATCCCAGCTAAACCAACTCCGAAACCTAGGGCTCCCACCAGGACAGGGATAGCCCTAAGGCAACAACGATCCCCTCCTCGTTCTCCCTCCCCAACGCTTTCCCCTATCCCGGTAGACTCAACCCGAGGTGCCCCCGCCCTAAGCGGCACGGCGGGTAACCTGGATTCGACCAGGTATATGGACCTCGAGTCTACCAGACCACACGTCCCAAAGCCCAATCCCACTCCTTCTACCTCCTATGCTGCCATGGCAGCTAGGCCAGGTGTTCCCACCACCCAGAGGACTTCCCAATCCTCACAAATTCCTCCCCCGAGGCCGAAGGGTCGTGCCCAGGAGGCCTACCTGTCGGAGGCCTCTGCCAGGGACAGTGCCATTAAATGGTACTGTTACGCCCTGGCGGAGGAGATGCCTTCGAAGGTGGCGGTCCGGGGCCTCCCTGCCGACACCGACGAGGCAGAAATCGTCAATGCCCTGAAGGAGCTGGGATTCCCGGCTCGATATGCCAGGTGCATTAGGTCCCAGAGAGGGCGTCCGGGCTGCGTGTTTCACGTAGCCCTGGATCACCTCTCGAAGGACGGTCTCGCCCGCTTGTACGCAGTCAACGAACTGCTGTACCTGCCGGGGGTGACGGTGGAAGGATGGCGTCCAACCCGAGGACCTGCGCAGTGTCATCGCTGCCAGGGCTTCGGACACGCCTCCTACAACTGTCATCGTGCGGTCCGTTGCGTAAGCCAGGAGCTTCGCATCATCTATTGGAACCCCGATGGGATAAGATCCCGAAAAAACGATCTCTTGGTTCTCGCCCAGGAGTACAACCCTGAGGTTCTGCTGCTGGGGGAGACCTTGTTAAAACCTCAGGATGTGTTCAGGATTCCCAACTATTTCATGTACCGACGTGACGAGCTTACCCCTGCCGGGCGGCCGTTCAGGGGCACTGCGGCCCTTGTCAGGCGGGACGTGGTGCATGATCAGTTGGATTTGCTGTCCTTCACATCGACAAGACCCCCGGGGCCTGAATTCCATCCTGAGGATATAAGACGGGCCCTGAATTACGACAGCCGCCCAGCTCTGCTGGTCGGGGACCTCAACGCGAAGCACGTCGCGTGGGGTTCCCGACTTAACACAGCAGTGGGCAGGCGGCTGTTAGAAGATGCCGATAGGGGCGACTACTCTGTGGTCGGCCCTGATGAACCCACGCACGTCCCGACCGCCGCGCGATACCAGCCCGATGTGCTGGACGTGTGTGTTCATAAGGGGCTACGGTGCCCCGTAACGATCGAGGCACTGTACGACCTGGGTACCCCACATCTCCCTGTCCTGGTGACACTGGGAATGGGGCTCACCCGGGTTGCGACTTCGCCCCTACGACCGAAGGTCGACTGGGAGCTCTTTAAGAGACGACTAGTCGACCTTCCCGTAATTCAGGACCCCAACACCCCTGAGGGGGTCGATGACGCGGCAGTCCGCCTTATCGACTCCATCAGGGGAGCGATTGACCAGGCGACGACTCTTGTGCCCAGCGGCGGGCCCAGAGGTAGACTCCCGGCCCATCTGAAGGCGATCATTCGCCGGAAGAGGGGCCTGAGGAGGCTCTGGGCGACAACTCGTTGTCCCAGGATCAAGCGCGAGCTTAATGAGTTGGAAGCGGAGTTGGCGGCGAAGATTAGCTCCTTTCGGGGCTATGCGTGGGAGGAACGGATTGAGGAGGCCCGTGAGGACCCCTCTTCCGTGTCCCTCCACCGACTTTGCCGCCAGCTCTCAAATCGGCCTGCCCCGACTTGTCCACTCGTGGACGAGAGGGGCAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATGTCCTGGCCGCAATGCTGGAGCGGCAGTTCGTTCCGAATGACTCTGCACCCTCAGAGGCCGCATTCCACCAATCGGTGGAAGAGAGCGTAGCGAACCTACTCTCCTCCCCGGTGCCACCGTTGGGAGATGATGTTTTCATCACTCCCAGTGAATTGCGCCTCTCCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGTGAGGACGGTATTCCCTCCCTCGCATTCTTCCACTTCCCTGAAACGGTCGTGTCATACATGACACGGCTGTTCAATTCCATTCTGTCCACAGGACACTTCCCGGGAATTTGGAAATTGGGCAAGGTTATCGCCTTGCCCAAACCCGGCAAGGATAGGAGAAATCCCTCCAGTTACCGTCCGATCACCTTGCTGTCGCATGTGGGCAAGTTGTTCGAGAGGCTGCTGCTGAGAAGGGTGTCGCCGCACATCCTTCCCAGACCCGAGCAGTTCGGGTTTCGCAGCGGTCACTCGACAACGCTGCAATTGGTCCGCGTCATGCATCACTTGGCGGATCGGTCCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGATATCGAGAAAGCCTTCGACCGTGTCTGGCATGCGGGACTGATCCACAAGCTGGTGCAGAACACGGACCTCCAGCACGCCTACGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCTTTGTCGCGGTCGAGGGCGCCAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCGCAGGGAAGCGTCCTGGCCCCACTCCTCTACGCTCTCTACACAAACGACATTCCCACGCTCGAGGGTAACCTCCAAGCGTGGGAAGTAGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCTCGTCATCCAACGTCCCCTCTGCGGCCATTTTGAGGATGCAGAGGCTTTTGGACCTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACTGCGGCTATCCTCTTCGGTCCGGTCCGCACAACAGTCGTCCCGGGACAGCTCAGTCTCCGTGGCGCTAATGTCGAGTTTAGATCCAGCGTCCGGTACTTGGGGGTCGATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAATAAGGCGTTGGCGGCCGCTCGCTGTGCGAGATTCCTCCTCCGGCCGGTGTTGGCCTCCAGGTTGCCGGTCAGGACTAAGCTCGGCATTTATAAGACGTATGTCCGTTCCCGTATCACGTACGCAGCTGAGGCCTGGTATCACCTCATCCCGCAGGGTATGCGGGCGAGGTTACAGGTCCAGCAAAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGAAATGACGTAATCGCCCGGGATCTAGATGTGGAGTCGCTCGAGGAGTTCATCCGGAGGCTAGCTCGTAATCTTTACGAGCGGGCTGACGGTGGACCCCACGAGCACCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTCGGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGGTAAGATAG
Protein
MSGGNSPPLISTPGPSHKGRQVMPQSSRYQPTPAARIGSMGLGTDSLPGPSVAAQRTLRIEPEEDNLPSLTDPSGPSRPRKKARSESDRGSSSDKDKRPRLGPSSRSEGEDSSTTSSAHSSTESVTPSSSRSSSPSGSPIPAKPTPKPRAPTRTGIALRQQRSPPRSPSPTLSPIPVDSTRGAPALSGTAGNLDSTRYMDLESTRPHVPKPNPTPSTSYAAMAARPGVPTTQRTSQSSQIPPPRPKGRAQEAYLSEASARDSAIKWYCYALAEEMPSKVAVRGLPADTDEAEIVNALKELGFPARYARCIRSQRGRPGCVFHVALDHLSKDGLARLYAVNELLYLPGVTVEGWRPTRGPAQCHRCQGFGHASYNCHRAVRCVSQELRIIYWNPDGIRSRKNDLLVLAQEYNPEVLLLGETLLKPQDVFRIPNYFMYRRDELTPAGRPFRGTAALVRRDVVHDQLDLLSFTSTRPPGPEFHPEDIRRALNYDSRPALLVGDLNAKHVAWGSRLNTAVGRRLLEDADRGDYSVVGPDEPTHVPTAARYQPDVLDVCVHKGLRCPVTIEALYDLGTPHLPVLVTLGMGLTRVATSPLRPKVDWELFKRRLVDLPVIQDPNTPEGVDDAAVRLIDSIRGAIDQATTLVPSGGPRGRLPAHLKAIIRRKRGLRRLWATTRCPRIKRELNELEAELAAKISSFRGYAWEERIEEAREDPSSVSLHRLCRQLSNRPAPTCPLVDERGNRCFSAQARADVLAAMLERQFVPNDSAPSEAAFHQSVEESVANLLSSPVPPLGDDVFITPSELRLSIKRMKRRKAPGEDGIPSLAFFHFPETVVSYMTRLFNSILSTGHFPGIWKLGKVIALPKPGKDRRNPSSYRPITLLSHVGKLFERLLLRRVSPHILPRPEQFGFRSGHSTTLQLVRVMHHLADRSNARQYTAAVFLDIEKAFDRVWHAGLIHKLVQNTDLQHAYVRLLGSYLEGRSFFVAVEGAKSSVRPVTAGVPQGSVLAPLLYALYTNDIPTLEGNLQAWEVDVKLALFADDSAYFSSSNVPSAAILRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTTVVPGQLSLRGANVEFRSSVRYLGVDIDRSLRMTAHANKALAAARCARFLLRPVLASRLPVRTKLGIYKTYVRSRITYAAEAWYHLIPQGMRARLQVQQNLALRTIVGAGRYVRNDVIARDLDVESLEEFIRRLARNLYERADGGPHEHLHNIAPLHARPPDGRALPRELLEPPAMVR

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
ABLF02042518    ABLF02057746    ABLF02034467    ABLF02036316    ABLF02036319    ABLF02048663    + More
ABLF02066977    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    NEVH01011985    PNF31054.1    NEVH01021205    PNF19912.1    GFTR01008279    JAW08147.1    KK119261    KFM75202.1    NEVH01017470    PNF24199.1    ABLF02017813    NEVH01007402    PNF35856.1    GALX01005359    JAB63107.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    NEVH01016302    PNF25823.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    NEVH01006736    PNF36716.1    GFXV01000908    MBW12713.1    NEVH01020940    PNF20481.1    GGMR01003407    MBY16026.1    GGFL01004957    MBW69135.1    GGMS01002992    MBY72195.1    GFTR01008257    JAW08169.1    GFTR01008246    JAW08180.1    GBBI01003747    JAC14965.1    GFTR01008261    JAW08165.1    AB055391    BAB21761.1    GEZM01084969    JAV60363.1    GBGD01000389    JAC88500.1    GGFL01005012    MBW69190.1    AB018558    BAA76304.1    AF081103    AAC72921.1    GFTR01008251    JAW08175.1    GBBI01003810    JAC14902.1    GGMR01006408    MBY19027.1    GFTR01008269    JAW08157.1    M22874    M38643    GGMS01006359    MBY75562.1    GGMR01000676    MBY13295.1    KK119692    KFM76444.1    U07847    AAA17752.1    GGMR01016296    MBY28915.1   
Pfam
PF00078   RVT_1        + More
PF07530   PRE_C2HC
PF14529   Exo_endo_phos_2
PF07727   RVT_2
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR006579   Pre_C2HC_dom       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=2.8429e-05,     Score=118

Ontologies

Topology

Length:
1268
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00366
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1268
 
 

Population Genetic Test Statistics

Pi
5.102859
Theta
5.121119
Tajima's D
-1.248383
CLR
5.821569
CSRT
0.0893455327233638
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号