SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12270
Annotation
PREDICTED:_nascent_polypeptide-associated_complex_subunit_alpha?_muscle-specific_form-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.446
 

Sequence

CDS
ATGTCAGGGGGGAGCCCCCCCATAATCAGCACCCCAGGCCCCTCCCATAAGGGACGCACAATAGGAACTAGCCTATTTGCCCAAACCCAAACTCGCCCAGGCCCGGACAATAAGCCCGGGCCTTCTGGAGCGTCCCAGGGACCGCCGAGAATCGGTTCGGGGGAAAGTTGCTTTCCCTTACCGACCGATAACTCGGGGACCCCTCGGCCGCGAAAGAAGGCCAGGTCCGAGTCCGACCGGGGCTCTTCTGAGGAGAAAGACAAGAGACCGAGGATAGGCCCCTCTTCTAGATCTGAGGGTGACGATAGCGAAGCTACCTCCATCACTCCTTCCTCTTCTGCATCCACATCTGCTTCGTCCTCCCCCTCCTCCTCTCGCTCAACGTCCCCCTCAAAGGAATCCCTTCCCTCACCCAAGAAACCCATCCCCAAACCTAGGGCACTCCCTAGGACGGTAGATGCTCCTAGGTTGAGAACCCCTCCGCGTTCTCCCTCTCCAGCACTCTCTCCTACCATGGCGGATAGTACTCGAGGTGCCCCCGCCTCAAGTTGCACGGCGGGCAACCTAGATTCAACTAGGTATGTGGACCTCGAGGCTACCCGACCCCCCCCTCCCTCAGTCCGAAAACTTCCTGACCCAATTCCGTCCACATCTTATGCGGCTATCGCCGCCTCCAAGCCAACTACTCCCAAGCCCCCAACACAGGTCCATCGAAATGTTCCTCCCCCGAGACCGAAGGGTCGCGCCCAGGAGGAACTGCGCCGACACCCGCCAGTAATGGTGGAGGCCCTTTCTAATTGGCCCCGCCACATGGCTGCCATTAGGGAGCGCCTAGGCCGCGCCCCCTCGGCGCGACCCTTCGGCACTGGTTTTAGGTTCCTGCCGTCGTCGGCTGAGGAATACAGGGCGGTCCAGGCCTACCTGTCGGAGGCCTCTGCCAGGGATAGTACCATTAAATGGTACTGCTATGCCCTGGCGGAGGAGATGCCCTCTAAGGTAGCTGTCCGGGGCCTCCCTGCCGACACCGACACGGCAGACGTTACCAACGCGTTGAAGGAGCTGGGGTTCCCGGCTCGATACGCTAGGTGCATTCGGTCCAAGAGAGGGCGACCGGGCAACGTGTTCCACGTTGCCCTGGATCACCTCTCAAAGGATGAACTCGCCCGCTTGTACTCAGTCAACGAACTGATGTACTTGCCGGGGGTGACGGTTGAGGGATGGCGACCAACCCGAGGGCCTGCGCAGTGTCACCGCTGCCAGGCCTACGGGCACGCCTCCCACAATTGTCACCGTGCGGTCCGCTGCGTGAGATGTGCTGCGGAGCACACTGTAGCGGACTGCCCGAGGCCGAGGGACGGCCCATTCTCCTGCGCCAATTGCGGGAAGGACCACGCCGCCGTTGATAGGCGGTGCCCGGTCTACCGCAAGAAGGCCAGGATGATGGGAGTAACCGTCCCTCCTCCGGTGCCACCGGTGCCACCGGTGCGTCGATCCGGGAATGCAGCTCCTTCCGCTGTAGCACCCACCTCGAAGGGGAAGGGGAAGGGGAAAGGGAAATCTTCCCAGCCCCAACCTCCTCCCACGTCCTCATTCATCCCCCCTGCCGTCACAGTGGAGGCCGAACCATCGGCGGCAACGCTGATGGCTGAAGCCAACACTCCGCGGCGGGGTAAACCTACTCCGACCCCACGTAGCTTCGCTATAACAAGACCGACCCCAAAACAAGACCGCGCTCCGGCCCGTGCCGGTGCCCCAACCCCACAAGCTCCAAATAAAAAAACCCTTAAAAACAGGAAAAAAAAGAGCAAAAGGAAATTGATGAAGAAAGCGCGAAGGGAGGCCTTAGAGAACGCTGCTCCCTCATCGGTTCCCGCAATACCTGCCTTAGACATGGAGGTTGACATCAACCCCACTACCGACCACATAATCGATGATCAACAACCTGGACCATCTTCACTGCCCCAGGCCCAACCGGCCACTTCAGGCATACAGCCCCCATTACCACCCCGCCCGCAGAGAGAGCGGCGCAGCGGCCGACAGGACACGCAGCCTGCCGGCTTCGCTGCCTGGCTCCTCTCCCTGTGGGAGAAACTGTCCGAGGAGCTGCGCATCATCTACTGGAACCCCGACGGGATAGGATCCCGGAGGTCGGAATTAATCCGACTCGCCCAGGAGTATGACCCGCAGGTTATCCTCCTGGGCGAGACCAAGCTCAAACCTCGACAAGATTTTAGGATGCCCAACTACTTCGTGTACCGACGGGACGAACTGACCTCCGCAGTGCCCCTGAACGGGCGCCCGTTCAGGGGCACTGCGGCGCTCGTCAGGAGGGACGTGGTGCACGAGGAGCTTGAGCTACTGACCTTCGCCTCTACCAGAACGGTCGGGGTGAGGGTCCACGTACCGGGGGCCGAATTGCGGATTTATGCCGCGTATCGACCCCCGGGTCCTGATTTTGTCGAGGACGATATTAGACGGGCCTTGAACCATGATCGCCATCCGGCCTTGGTGGTCGGGGACCTCAATGCGAAACATGTCGCTTGGGGCTCCCGAATCATCACGCCGCCCGGAAGGCGATTGTACGAGGATGCCGAAAGGGGGGACTACTGCGTGGTCGGCCCCAACGAACCCACACACGTTCCAACGTTGGCCCGGTACCAACCGGACGTATTGGACGTGTGTGTTCACAAGGGGCTACAGTGCCCTCTAGCGATAGAGGCACTGTACGACCTGAGTACCCCTCACCTACCGATCTTGGTCACGGTGGGTTTGGGGCTCACTCGGGTCGCGACATCCCCTCTCAGGCCTAGGGTCGACTGGCAGTCCTTTACGGGACTGCTGGCCGACCAATCCTTGTTTCAAGACCCGTCTACCCCTGATGAGGTCGACACGGCGGCTTCCCGTCTCGTCGACACCATCAGGGGAGCCCTGGACCAAGTGACGACTCTGGTACCCAGCGGGGGGCCCAGAGCGGAACTCCCGGTGCACCTCAAGACGTTAATTCGTCGGAAGAGGGCACTGAGGAGGCTCTGGGCGACATCTAGGTGTCCCAGGATTAAGCGCGAGCTCAACCGACTTGAGGGGGAGCTGGCGACTAAGATGCGGACTTACCGGGGTGATTCCTGGGAGGGGGGACTGTTGGACGCGTCCGACGACCTTCTGGCCAACTCGCTGGAGCGGCAGTTCACTCCGAATGTCTCTGCACCCTCGATGGCTGCATTCCATCGCGAGGTGTCAGAGGGTGTAATCCACTTCCTCAAACCGGAATCGCCGGGAGTCGAGCTGGGAGATGACGACTTAGTCACTCCCGGCGAGGTGCGCCTCCTCATCAAGTTGATGAAGAGGCGCAAAGCCCCCGGCGAGGACGGTATTCCTCCCCTCGCCCTGCAAAACCTCCCTCCCTCAATCGTGTCAGCAATGACACGATTGTTTAATTCCATTCTCCGGGTAGGACACTTCCCTGGAACTTGGAAACTGGGCAAGATCATCGTCTTGCCCAAACCCGGCAAGGACAGGAGAAAGCCCTCCAGTTACCGACCGATTACCTTGCTCTCGCACGTGGGCAAGTTGTTCGAGCGGCTGCTCCTGAGGAGAATATCGCCGTATATTCTCCTCAGGCCGGAGCAATTCGGCTTTAGAAGCGGCCACTCGACGACTCTGCAACTGACCCGTGTCCTGCATCACTTGGCGGACCGGCGAAACTCGGGCCAATACACGGTCGCGGTCCTCCTCGATATCGAGAAGGCCTTCGACCGTGTGTGGCACGAGGGGCTGGTCCACAAGCTGCGGGACGCGGGCCTACCGCACGCTCACGTGCGACTGCTCGGGTCGTATCTGGAGGGCAGAACCTTCTTTGTCGCGGTCGAGGGCGCACGGTCTTCCGTGCGTCCCATTACGGCCGGGGTTCCCCAGGGTAGTGTCCTATCACCTATCCTATACGCCCTCTACACCAATGACATCCCCACCCTGGAGGGTCACCTTCGGGCGTGGGAGGAGGACGTGAAGTTGGCCTTGTTCGCTGACGACTCGGCCTACTTCTCGTCCTCTCCGTTCCCCTCTGCAGCCATTATGAGGATGCAGAGGCTTTTGGATTTACTGCCCCAGTGGCTGGACCGTTGGAGAGTCGCGGTCAATGTGGGAAAGACCGCGGCCTTACTCTACGGTCCGGTCCGTATCAGAGTCGTCCCAAAGAAACTCAGCCTCCGAGGTGTGAATGTCGAGTTCAGGACCACGGTCCGGTATCTCGGATGCGACATCGACCGCTCCTTGAGCATGGTCGCGCACGTCAACCGAGTCATCGGTCAGACTCGCGCGGCCAGGTTCTTGTTGCGGCCGCGATCTAGGTTGCAGGCCCAGCAGAGTCTTTCCCTCCGCATTATCGTCGGGGCCGGGCAGTACGTCAGAAATGACGTTATTGCCCGGGACCTAGGTGTGGAGTCGCTCGTGGAGTTTGTGACTAGGCTCGCCCGTAATATGTACGAGCGAGCCGAAAACGGGCCCCATGAGCATCTCCACAACATAGCCCCGCTGCACGCCAGACCACCGGATGGTACGGCGTTGCCGCGGGAGCTATTGGTACCCCCGACGATCGTTCGGAGATAA
Protein
MSGGSPPIISTPGPSHKGRTIGTSLFAQTQTRPGPDNKPGPSGASQGPPRIGSGESCFPLPTDNSGTPRPRKKARSESDRGSSEEKDKRPRIGPSSRSEGDDSEATSITPSSSASTSASSSPSSSRSTSPSKESLPSPKKPIPKPRALPRTVDAPRLRTPPRSPSPALSPTMADSTRGAPASSCTAGNLDSTRYVDLEATRPPPPSVRKLPDPIPSTSYAAIAASKPTTPKPPTQVHRNVPPPRPKGRAQEELRRHPPVMVEALSNWPRHMAAIRERLGRAPSARPFGTGFRFLPSSAEEYRAVQAYLSEASARDSTIKWYCYALAEEMPSKVAVRGLPADTDTADVTNALKELGFPARYARCIRSKRGRPGNVFHVALDHLSKDELARLYSVNELMYLPGVTVEGWRPTRGPAQCHRCQAYGHASHNCHRAVRCVRCAAEHTVADCPRPRDGPFSCANCGKDHAAVDRRCPVYRKKARMMGVTVPPPVPPVPPVRRSGNAAPSAVAPTSKGKGKGKGKSSQPQPPPTSSFIPPAVTVEAEPSAATLMAEANTPRRGKPTPTPRSFAITRPTPKQDRAPARAGAPTPQAPNKKTLKNRKKKSKRKLMKKARREALENAAPSSVPAIPALDMEVDINPTTDHIIDDQQPGPSSLPQAQPATSGIQPPLPPRPQRERRSGRQDTQPAGFAAWLLSLWEKLSEELRIIYWNPDGIGSRRSELIRLAQEYDPQVILLGETKLKPRQDFRMPNYFVYRRDELTSAVPLNGRPFRGTAALVRRDVVHEELELLTFASTRTVGVRVHVPGAELRIYAAYRPPGPDFVEDDIRRALNHDRHPALVVGDLNAKHVAWGSRIITPPGRRLYEDAERGDYCVVGPNEPTHVPTLARYQPDVLDVCVHKGLQCPLAIEALYDLSTPHLPILVTVGLGLTRVATSPLRPRVDWQSFTGLLADQSLFQDPSTPDEVDTAASRLVDTIRGALDQVTTLVPSGGPRAELPVHLKTLIRRKRALRRLWATSRCPRIKRELNRLEGELATKMRTYRGDSWEGGLLDASDDLLANSLERQFTPNVSAPSMAAFHREVSEGVIHFLKPESPGVELGDDDLVTPGEVRLLIKLMKRRKAPGEDGIPPLALQNLPPSIVSAMTRLFNSILRVGHFPGTWKLGKIIVLPKPGKDRRKPSSYRPITLLSHVGKLFERLLLRRISPYILLRPEQFGFRSGHSTTLQLTRVLHHLADRRNSGQYTVAVLLDIEKAFDRVWHEGLVHKLRDAGLPHAHVRLLGSYLEGRTFFVAVEGARSSVRPITAGVPQGSVLSPILYALYTNDIPTLEGHLRAWEEDVKLALFADDSAYFSSSPFPSAAIMRMQRLLDLLPQWLDRWRVAVNVGKTAALLYGPVRIRVVPKKLSLRGVNVEFRTTVRYLGCDIDRSLSMVAHVNRVIGQTRAARFLLRPRSRLQAQQSLSLRIIVGAGQYVRNDVIARDLGVESLVEFVTRLARNMYERAENGPHEHLHNIAPLHARPPDGTALPRELLVPPTIVRR

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=1.16315e-05,     Score=122

Ontologies

GO

Topology

Length:
1533
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01055
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1533
 
 

Population Genetic Test Statistics

Pi
1.554422
Theta
3.076066
Tajima's D
-0.376935
CLR
36.623478
CSRT
0.28403579821009
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号