SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12253
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 2.643
 

Sequence

CDS
ATGGCGGCCATCAGGGAGCGCTTAGGGCGGGCCCCCTCTGTGCGCCCTTACGGGTCAGGCTTCAGATTTCTGCCGGCGTCGGCAGAGGAGTATAGGGTGGTCCAAGCCTATCTCGCGGGAGCCTCCTCCGCTGACAGTGCCATTAAATGGTACTGTTACGCATTGGAGGAGGATATTCCCGCGAGAGTGGCAATTCGAGGCCTACCTGCCGACACCGACGCGGCAGAAATCGTAGACTCTTTAAAGGAGTTAGGGTTTCCGGCTCGTTATGCTCGGTGTATACGGGCCAAGAGAGGGCGGCCGGGTTGCGTCTTTTACGTAACCCTGGACCACCTCTCCAAGGATGACCTCGCCCGCTTGTACGCAGTTGAAGAACTGCTGTACTTGCCGGGGGTGTCAGTTGAGGGATGGCGTCCAAGCCGAGGACCTGCGCAGTGTCATCGCTGCCAGGCCTTCGGACACGCCTCCAACAACTGCCACCGAGCAGTCCGCTGCGTGCGATGTGCGGGTGAGCACATTGTGGCGGACTGCCCGAGGCCAAGGGAGGGACCCTTCATCTGCGCCAACTGCGGGAAGGGCCACGCCGCTGTTGACAAGCGGTGTGTGTTCTACCGCAGGAGGGCGCGGATGATGGGGGTCACTATTCCTCCCCCCGTACCGCCAGCGAGGCGCGCCGGTCAAGCCCCTACCCCTGCTCCACGTCCCGCACCAAGTCCATCTTGGAAGGGCAAGGGCAAGGGAAAGAGTTCACAAGCCCCCCCTTTCCCTCCGGTTAATACTCAACCTGCCACCGTGGAGGCCAGCGCAACAGCGGCTACCCTGATGGCAGAGGCGAACCCTCAACGACAGGCCATAAAGCCCCGCCCGGCCCCCCGTTCAATCAACAAGGCAGGGACTGATCTCCAACTCACTGTACTGACCAAATCTCAAAAAAAAAACAAAAAGAAAAAAATGAAAGCCAGAGAGAAGAAAAAAAAAGAAAAGGAAGAAGCAGCCGCCATGAGTGAAGGACAAGCTGCCCAGACGATCCAACCTCCATCTCCCATGGAGATAACAGTCACCGACCCGCCCCAGAACACGAATACTCTGGGCGACTCGCAGCCCCCACTTCCTCCCCGCCCGCAGCGGGAGAGGCGCAGAGATCGGCAGGACACGCAGCCTGTCGGCCTCGCTGCCTGGCTCCTCTCCCTGTGGGAGAAACTGTCCGAGCGCAGCTCAATGGCTAGCCAAGAGCTGCGCATCATCTACTGGAACCCCGACGGGATAGGGTCCCGGAGGCCGGAGCTCATCCGACTCGCCCAAGAGCATGACCCGCAGGTCATCCTCTTGGGCGAGACCAAACTCAAACCTCGACAAGATTTTAGGATGCCCAACTACTTCGTGTACCGACGGGACGAACTGACCTCCAACGGGCGCCCGTTCAGGGGCACTGCGGCGCTCGTCAGGAGGGACGTGGTGCACGAGGAGCTTGAGCTACTGACCTTCGCCTCTACCAGAACGGTCGGGGTGAGGGTTCACGTACTGGGGGCCGAATTGCGGATTTATGCCGCGTATCGACCCCCGGGTCCTGATTTTGTCGAGGACGATATTAGACGGGCCTTGAACCATGATCGCCATCCGGCCTTGGTGGTCGGGGACCTCAATGCGAAACATGTCGCTTGGGGCTCCCGAATCATCACGGCGCCCGGAAGGCGATTGTACGAGGATGCCGAAAGGGGGGACTACTGCGTGGTCGGCCCCAACGAACCCACTCACGTTCCAACGTTGGCCCGGTACCAACCGGACGTCTTGGACGTGTGTGTACACAAGGGGTTACGGTGCCCTCTAGCGATAGAGGCACTGTACGACCTGAGTACCCCTCACCTACCGATCTTGGTCTCGGTGGGTTTGGGGCTCACTCGGGTCGCGACATCCCCTCTCAGGCCTAGGGTCGACTGGCAGTCCTTTACGGGACTGCTGGCCGACCAATCCTTGTTTCAAGACCCGTCTACCCCTGATGAGGTCGACACGGCGGCTTCCCGTCTCGTCGACACCATCAGGGGAGCCCTGGACCAAGCGACGACTCTGGTACCCAGCGGGGGGCCCAGAGTGGAACTCCCGGTGCACCTCAAGACGTTAATTCGTCGGAAGAGGGCACTGAGGAGGCTCTGGGCGACATCTAGGTGTCCCAGGATCAAGCGCGAGCTAAACCGACTTGAGGATGAGCTGGCGACTAAGATGCGGACTTTCCGGGGTGACTCCTGGGAGGGGGGACTGTTGGACGCGTCCGACGACCGTACGATGGCCCCCCTTCACCGCATCTGTCGCCGGCTCACCCACAAGCCTTCCCCCACTTGTCCCCTGGAGGATGAGGCGGGAAGACGGTGTTTTACACCGGTGGCTCGTGCCGAAGTCCTGGCCAACTCGCTGGAGGGGCAGTTCACTCCGAATGTCTCTGCGCCCTCGATGGTTGCATTCCATCGGGAGGTGGCAGAGGGTGTAATCCAACTCCTCAAACCGGAATCGCCGGGAGTCGAGCTGGGAGATGACGATCTAGTCACTCCCAGCGAGGTGCGCCTCCTCATCAAGTTGATGAAGAGGCGCAAAGCCCCCGGCGAGGACTGTATTCCTCCCCTCGCCCTGCAAAACCTCCCACCCTCAATCGTGTCAGCAATGACACGATTGTTTAATTCCATTCTCCGGGTAGGACACTTCCCTGGAACTTGGAAATTGGGCAAGATTATCGTCTTGCCCAAACCCGGCAAGGACAGGAGAAAGCCCTCCAGTTACCGACCGATTACCTTGCTGTCGCACGTGGGCAAGTTGTTCGAGCGGCTGCTCCTGAGGAGAATATCGCCGTATATTCTCCTCAGGCCGGAGCAATTCGGCTTTAGAAGCGGCCACTCGACGACTCTGCAACTGACCCGTGTCCTGCATCACTTGGCGGACCGGCGTAACTCGGGCCAATACACGGTCGCAGTCCTTCTCGATATCGAGAAGGCCTTCGACCGTGTGTGGCACGAGGGGTTGGTCCACAAGCTGCGGGACGCGGGCCTACCGCACGCTCACGTGCGACTGCTCGGGTCGTATCTGGAGGGCAGAACCTTCTTTGTCGCGGTCGAGGGCGCTCGGTCTTCCGTGCGTCCCATTACGGCCGGAGTTCCTCAGGGTAGTGTCCTATCACCTATCCTATACGCCCTCTACACCAATGACATCCCCACCCTGGAGGGTCACCTTCGAGCGTGGGAGGAGGACGTGAAGTTGGCCTTGTTCGCAGATGACTCGGCCTACTTCTCGTCCTCTCCGTTCCCCTCTGCAGCCATTATGAGGATGCAGAGGCTTTTGGATTTACTGCCCCAGTGGCTGGACCGTTGGAGAGTCGCGGTCAATGTGGGAAAGACCGCGGCCTTGCTCTACGGTCCGGTCCGTATTAGAGTCGTCCCCAAGAAACTCAGTCTCCGAGGTGTGAATGTCGAGTTCAGGACCATGGTCCGGTATCTCGGGTGCGACATCGACCGCTCCTTGAGCATGGTCGCGCACGTCAACCGAGTCATCGGTCAGACTCGCGCGGCCAGGTTCTTGCTGCGGCCGGTACTTGCGTCCGGGCTTCCGACCAGGACCAAACTCGCCATTTACAGGACATACGTCCGTTCCCGCCTCACATACGCTGCTGAGGCCTGGTATCACCTGTTGTCGCCGTCCCAGCGATCTAGGTTGCAGGCCCAGCAGAGTCTTTCCCTCCGTACTATCGTCGGGGCCGGGCGGTACGTCAGAAATGACGTCATCGCCCGGGACCTAGGGGTGGAGTCGCTCAGGGAGTTCGTGACTAGGCTCGCTCGTAATATGTACGAGCGAGCCGAAAACGGCCCCCATGAGCATCTCCACAACATAGCCCCGCTGCACGCCAGACCACCCGATGGTACGGCGTTGCCGCGGGAGCTATTGGTACCCCCGACGATCGTTCGGAGATAA
Protein
MAAIRERLGRAPSVRPYGSGFRFLPASAEEYRVVQAYLAGASSADSAIKWYCYALEEDIPARVAIRGLPADTDAAEIVDSLKELGFPARYARCIRAKRGRPGCVFYVTLDHLSKDDLARLYAVEELLYLPGVSVEGWRPSRGPAQCHRCQAFGHASNNCHRAVRCVRCAGEHIVADCPRPREGPFICANCGKGHAAVDKRCVFYRRRARMMGVTIPPPVPPARRAGQAPTPAPRPAPSPSWKGKGKGKSSQAPPFPPVNTQPATVEASATAATLMAEANPQRQAIKPRPAPRSINKAGTDLQLTVLTKSQKKNKKKKMKAREKKKKEKEEAAAMSEGQAAQTIQPPSPMEITVTDPPQNTNTLGDSQPPLPPRPQRERRRDRQDTQPVGLAAWLLSLWEKLSERSSMASQELRIIYWNPDGIGSRRPELIRLAQEHDPQVILLGETKLKPRQDFRMPNYFVYRRDELTSNGRPFRGTAALVRRDVVHEELELLTFASTRTVGVRVHVLGAELRIYAAYRPPGPDFVEDDIRRALNHDRHPALVVGDLNAKHVAWGSRIITAPGRRLYEDAERGDYCVVGPNEPTHVPTLARYQPDVLDVCVHKGLRCPLAIEALYDLSTPHLPILVSVGLGLTRVATSPLRPRVDWQSFTGLLADQSLFQDPSTPDEVDTAASRLVDTIRGALDQATTLVPSGGPRVELPVHLKTLIRRKRALRRLWATSRCPRIKRELNRLEDELATKMRTFRGDSWEGGLLDASDDRTMAPLHRICRRLTHKPSPTCPLEDEAGRRCFTPVARAEVLANSLEGQFTPNVSAPSMVAFHREVAEGVIQLLKPESPGVELGDDDLVTPSEVRLLIKLMKRRKAPGEDCIPPLALQNLPPSIVSAMTRLFNSILRVGHFPGTWKLGKIIVLPKPGKDRRKPSSYRPITLLSHVGKLFERLLLRRISPYILLRPEQFGFRSGHSTTLQLTRVLHHLADRRNSGQYTVAVLLDIEKAFDRVWHEGLVHKLRDAGLPHAHVRLLGSYLEGRTFFVAVEGARSSVRPITAGVPQGSVLSPILYALYTNDIPTLEGHLRAWEEDVKLALFADDSAYFSSSPFPSAAIMRMQRLLDLLPQWLDRWRVAVNVGKTAALLYGPVRIRVVPKKLSLRGVNVEFRTMVRYLGCDIDRSLSMVAHVNRVIGQTRAARFLLRPVLASGLPTRTKLAIYRTYVRSRLTYAAEAWYHLLSPSQRSRLQAQQSLSLRTIVGAGRYVRNDVIARDLGVESLREFVTRLARNMYERAENGPHEHLHNIAPLHARPPDGTALPRELLVPPTIVRR

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=8.26531e-05,     Score=114

Ontologies

Topology

Length:
1316
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01085
Exp number, first 60 AAs:
0.00078
Total prob of N-in:
0.00006
outside
1  -  1316
 
 

Population Genetic Test Statistics

Pi
420.7669
Theta
196.273988
Tajima's D
3.328393
CLR
0.095271
CSRT
0.990150492475376
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号