SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12252
Annotation
PREDICTED:_nascent_polypeptide-associated_complex_subunit_alpha?_muscle-specific_form-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.389
 

Sequence

CDS
ATGTCAGGGGGGAGCCCCCCCATAATCAGCACCCCAGGCCCCTCCCATAAGGGACGCACAATAGGAACTAGCCTATTTGCCCAAACCCAAACTCGCCCAGGCCCGGACAATAAGCCCGGGCCTTCTGGAGCGGCCCAGGGACCGCCGAGAATCGGTTCGGGGGAAAGTTGCTTTCCCTTACCGACCGATAACTCGGGGACCCCTCGGCCGCGAAAGAAGGCCAGGTCCGAGTCCGACCGGGGCTCTTCTGAGGAGAAAGACAAGAGACCGAGGATAGGTCCCTCTTCCAGATCCGAGGGTGACGATAGCGAAGCTACCTCCGTCACTCCTTCCTCTTCTGCATCCACATCTGCTTCGTCCTCCCCCTCCTCCTCTCGCTCAACGTCCCCCTCAAAGGAATCCCTTCCCTCACCCAAGAAACCCATCCCCAAACCTAGGGCACTCCCTAGGACGGTAGATGCTCCTAGGTTGAGAACCCCTCCGCGTTCTCCCTCTCCAGCACTCTCTCCTATCATGGCGGATAGTACTCGAGGTGCCCCCGCCTCAAGTTGCACGGCGGGCAACCTAGATTCAACTAGGTATGTGGACCTCGAGGCTACCCGACCCCCCCCTCCCTCAGTCCGAAAACTTCCTGACCCAATTCCGTCCACATCTTATGCGGCTATAGCCGCCTCCAAGCCAATTACTCCCAAGCCCCCAACTCAGGTCCATCGAAATGTTCCTCCCCCGAGACCGAAGGGTCGCGCCCAGGAGGAACTGCGCCGACACCCGCCAATAATGGTGGAGGCCCTTTCTAATTGGCCCCGCCACATGGCTGCCATTAGGGAGCGCCTAGGCCGCGCCCCCTCGGCGCGACCCTTCGGCACTGGTTTTAGGTTCCTGCCGTCGTCGGCTGAGGAATACAGGGCGGTCCAGGCCTACCTGTCGGAGGCCTCTGCCAGGGATAGTACCATTAAATGGTACTGCTATGCCCTGGCGGAGGAGATGCCCTCCAAGGTAGCTGTCCGGGGCCTCCCTGCCGACACCGACACGGCAGACGTTACCAACGCGTTGAAGGAGCTGGGGTTCCCGGCTCGATACGCTAGGTGCATTCGGTCCAAGAGAGGGCGACCGGGCAGCGTATTCCACGTTGCCCTGGATCACCTCTCAAAGGATGAACTCGCCCGCTTGTACTCAGTCAACGAACTGATGTACTTGCCGGGGGTGACGGTTGAGGGATGGCGACCAACCCGAGGGCCTGCGCAGTGTCACCGCTGCCAGGCCTACGGGCACGCCTCCCACAATTGTCACCGTGCGGTCCGCTGCGTGAGATGTGCTGCGGAGCACACTGTAGCGGACTGCCCGAGGCCGAGGGACGGCCCATTCTCCTGCGCCAATTGCGGGAAGGACCACGCCGCCGTTGATAGGCGGTGCCCGGTCTACCGCAAGAAGGCCAGGATGATGGGAGTAACCGTCCCTCCTCCGGTGCCACCGGTGCCACCGGTGCGTCGATCCGGGAATGCAGCTCCTTCCGCTGTAGCACCCACCTCGAAGGGGAAGGGGAAGGGGAAAGGGAAATCTTCCCAGCCCCAACCTCCTCCCACGTCCTCATTCATCCCCCCTGCCGTCACAGTGGAGGCCGAACCATCGGCGGCAACGCTGATGGCTGAAGCCAACACTCCGCGGCGGGGTAAACCTACTCCGACCCCACGTAGCTTCGCTATAACAAGACCGACCCCAAAACAAGACCGCGCTCCGGCCCGTGCCGGTGCCCCAACCCCACAAGCTCCAAATAAAAAAACCCTTAAAAACAGGAAAAAAAAGAGCAAAAGGAAATTGATGAAGAAAGCGCGAAGGGAGGCCTTAGAGAACGCTGCTCCCTCATCGGTTCCCGCAATACCTGCCATAGACATGGAGGTTGACATCAACCCCACTACCGACCACATAATCGATGATCAACAACCTGGACCATCTTCATTGCCCCAGGCCCAACCGGCCACTTCAGGCATACAGCCCCCATTACCACCCCGCCCGCAGAGGGAGCGGCGCAGCGGCCGACAGGACACGCAGCCTGCCGGCTTCGCTGCCTGGCTCCTCTCCCTGTGGGAGAAACTGTCCGAGGAGCTGCGCATCATCTACTGGAACCCCGACGGGATAGGGTCCCGGAGGTCGGAGCTCATCCGACTCGCCCAGGAGTATGACCCGCAGGTTATCCTCCTGGGCGAGACCAAGCTCAAACCTCGACAAGATTTTAGGATGCCCAACTACTTCGTGTACCGACGGGACGAACTGACCTCCAGCGGGCGCCCGTTCAGGGGCACTGCGGCGCTCGTCAGGAGGGACGTGGTGCACGAGGAGCTTGAGCTACTGACCTTCGCCTCTACCAGAACGGTCGGGGTGAGGGTCCACGTACCGGGGGCCGAATTGCGGATTTATGCCGCGTATCGACCCCCGGGTCCTGATTTTGTCGAGGACGATATTAGACGGGCCTTGAACCATGATCGCCATCCGGCCTTGGTGGTCGGGGACCTCAATGCGAAACATGTCGCTTGGGGCTCCCGAATCATCACGCCGCCCGGAAGGCGATTGTACGAGGATGCCGAAAGGGGGGACTACTGCGTGGTCGGCCCCAACGAACCCACACACGTTCCAACGTTGGCCCGGTACCAACCGGACGTATTGGACGTGTGTGTTCACAAGGGGCTACAGTGCCCTCTAGCGATAGAGGCACTGTACGACCTGAGTACCCCTCACCTACCGATCTTGGTCACGGTGGGTTTGGGGCTCACTCGGGTCGCGACATCCCCTCTCAGGCCTAGGGTCGACTGGCAGTCCTTTACGGGACTGCTGGCCGACCAATCCTTGTTTCAAGACCCGTCTACCCCTGATGAGGTCGACACGGCGGCTTCCCGTCTCGTCGACACCATCAGGGGAGCCCTGGACCAAGTGACGACTCTGGTACCCAGCGGGGGGCCCAGAGCGGAACTCCCGGTGCACCTCAAGACGTTAATTCGTCGGAAGAGGGCACTGAGGAGGCTCTGGGCGACATCTAGGTGTCCCAGGATTAAGCGCGAGCTCAACCGACTTGAGGGGGAGCTGGCGACTAAGATGCGGACTTACCGGGGTGATTCCTGGGAGGGGGGACTGTTGGACGCGTCCGACGACCGTACGATGGCCCCCCTTCACCGCATCTGTCGCCGGCTCACCAACAAGCCTTCCCCCACTTGCCCCTTGGAGGACGAGGGGGGAAGACGGTGTTTTACACCGTTGGCTCGTGCCGAAGTCCTGGCCAACTCGCTGGAGCGGCAGTTCACTCCGAATGTCTCTGCACCCTCGATGGCTGCATTCCATCGCGAGGTGTCAGAGGGTGTAATCCACTTCCTCAAACCGGAATCGCCGGGAGTCGAGCTGGGAGATGACGACTTAGTCACTCCCAGCGAGGTGCGCCTCCTCATCAAGTTGATGAAGAGGCGCAAAGCCCCCGGCGAGGACGGTATTCCTCCCCTCGCCCTGCAAAACCTCCCTCCCTCAATCGTGTCAGCAATGACACGATTGTTTAATTCCATTCTCCGGGTAGGACTCTTCCCTGGAACTTGGAAACTGGGCAAGATCATCGTCTTGCCCAAACCCGGCAAGGACAGGAGAAAGCCCTCCAGTTACCGACCGATTACCTTGCTCTCGCACGTGGGCAAGTTGTTCGAGCGGCTGCTCCTGAGGAGAATATCGCCGTATATTCTCCTCAGGCCGGAGCAATTCGGCTTTAGAAGCGGCCACTCGACGACTCTGCAACTGACCCGTGTCCTGCATCACTTGGCGGACCGGCGAAACTCGGGCCAATACACGGTCGCGGTCCTCCTCGATATCGAGAAGGCCTTCGACCGTGTGTGGCACGAGGGGCTGGTCCACAAGCTGCGGGACGCGGGCCTACCGCACGCTCACGTGCGACTGCTCGGGTCGTATCTGGAGGGTAGAACCTTCTTTGTCGCGGTCGAGGGCGCACGGTCTTCCGTGCGTCCCATTACGGCCGGGGTTCCCCAGGGTAGTGTCCTATCACCTATCCTATACGCCCTCTACACCAATGACATCCCCACCCTGGAGGGTCACCTTCGGGCGTGGGAGGAGGACGTGAAGTTGGCCTTGTTCGCTGACGACTCGGCCTACTTCTCGTCCTCTCCGTTCCCCTCTGCAGCCATTATGAGGATGCAGAGGCTTTTGGATTTACTGCCCCAGTGGCTGGACCGTTGGAGAGTCGCGGTCAATGTGGGAAAGACCGCGGCCTTACTCTACGGTCCGGTCCGTATCAGAGTCGTCCCAAAGAAACTCAGCCTCCGAGGTGTGAATGTCGAGTTCAGGACCACGGTCCGGTATCTCGGATGCGACATCGACCGCTCCTTGAGCATGGTCGCGCACGTCAACCGAGTCATCGGTCAGACTCGCGCGGCCAGGTTCTTGTTGCGGCCGGTGTTTGCGTCCGGGCTTCCGACCAGGACCAAACTCGCCATTTACAAGACATACGTCCGTTCCCGCCTCACATACGCTGCTGCGGCCTGGTATCACCTGTTGTCGCCGTCCCAGCGATCTAGGTTGCAGGCCCAGCAGAGTCTTTCCCTCCGCATTATCGTCGGGGCCGGGCAGTACGTCAGAAATGACGTTATTGCCCGGGACCTAGGTGTGGAGTCGCTCGTGGAGTTTGTGACTAGGCTCGCCCGTAATATGTACGAGCGAGCCGAAAACGGGCCCCATGAGCATCTCCACAACATAGCCCCGCTGCACGCCAGACCACCGGATGGTACGGCGTTGCCGCGGGAGCTATTGGTACCCCCGACGATCGTTCGCAGATAA
Protein
MSGGSPPIISTPGPSHKGRTIGTSLFAQTQTRPGPDNKPGPSGAAQGPPRIGSGESCFPLPTDNSGTPRPRKKARSESDRGSSEEKDKRPRIGPSSRSEGDDSEATSVTPSSSASTSASSSPSSSRSTSPSKESLPSPKKPIPKPRALPRTVDAPRLRTPPRSPSPALSPIMADSTRGAPASSCTAGNLDSTRYVDLEATRPPPPSVRKLPDPIPSTSYAAIAASKPITPKPPTQVHRNVPPPRPKGRAQEELRRHPPIMVEALSNWPRHMAAIRERLGRAPSARPFGTGFRFLPSSAEEYRAVQAYLSEASARDSTIKWYCYALAEEMPSKVAVRGLPADTDTADVTNALKELGFPARYARCIRSKRGRPGSVFHVALDHLSKDELARLYSVNELMYLPGVTVEGWRPTRGPAQCHRCQAYGHASHNCHRAVRCVRCAAEHTVADCPRPRDGPFSCANCGKDHAAVDRRCPVYRKKARMMGVTVPPPVPPVPPVRRSGNAAPSAVAPTSKGKGKGKGKSSQPQPPPTSSFIPPAVTVEAEPSAATLMAEANTPRRGKPTPTPRSFAITRPTPKQDRAPARAGAPTPQAPNKKTLKNRKKKSKRKLMKKARREALENAAPSSVPAIPAIDMEVDINPTTDHIIDDQQPGPSSLPQAQPATSGIQPPLPPRPQRERRSGRQDTQPAGFAAWLLSLWEKLSEELRIIYWNPDGIGSRRSELIRLAQEYDPQVILLGETKLKPRQDFRMPNYFVYRRDELTSSGRPFRGTAALVRRDVVHEELELLTFASTRTVGVRVHVPGAELRIYAAYRPPGPDFVEDDIRRALNHDRHPALVVGDLNAKHVAWGSRIITPPGRRLYEDAERGDYCVVGPNEPTHVPTLARYQPDVLDVCVHKGLQCPLAIEALYDLSTPHLPILVTVGLGLTRVATSPLRPRVDWQSFTGLLADQSLFQDPSTPDEVDTAASRLVDTIRGALDQVTTLVPSGGPRAELPVHLKTLIRRKRALRRLWATSRCPRIKRELNRLEGELATKMRTYRGDSWEGGLLDASDDRTMAPLHRICRRLTNKPSPTCPLEDEGGRRCFTPLARAEVLANSLERQFTPNVSAPSMAAFHREVSEGVIHFLKPESPGVELGDDDLVTPSEVRLLIKLMKRRKAPGEDGIPPLALQNLPPSIVSAMTRLFNSILRVGLFPGTWKLGKIIVLPKPGKDRRKPSSYRPITLLSHVGKLFERLLLRRISPYILLRPEQFGFRSGHSTTLQLTRVLHHLADRRNSGQYTVAVLLDIEKAFDRVWHEGLVHKLRDAGLPHAHVRLLGSYLEGRTFFVAVEGARSSVRPITAGVPQGSVLSPILYALYTNDIPTLEGHLRAWEEDVKLALFADDSAYFSSSPFPSAAIMRMQRLLDLLPQWLDRWRVAVNVGKTAALLYGPVRIRVVPKKLSLRGVNVEFRTTVRYLGCDIDRSLSMVAHVNRVIGQTRAARFLLRPVFASGLPTRTKLAIYKTYVRSRLTYAAAAWYHLLSPSQRSRLQAQQSLSLRIIVGAGQYVRNDVIARDLGVESLVEFVTRLARNMYERAENGPHEHLHNIAPLHARPPDGTALPRELLVPPTIVRR

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=1.85595e-06,     Score=129

Ontologies

GO

Topology

Length:
1606
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01607
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1606
 
 

Population Genetic Test Statistics

Pi
196.364226
Theta
170.503434
Tajima's D
0.260269
CLR
135.516925
CSRT
0.451627418629069
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号