SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO12130
Pre Gene Modal
BGIBMGA008125
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 3.019
 

Sequence

CDS
ATGGCAGCTAGGCCGAGTATTCCTTCCACCCAGAGGCCATCCCAATCCTCTCATGTCCCTCTCCCGAGGCCGAAGGGTCGTGCCCAAGAGGAGCTGCGCCGACATCCGCCAATAATGGTGGAGGCCCTCCCTAATTGGTCCCGCCACATGGCGGCCATTAGGGAGCGCCTCGGTCGCGCCCCCTCGGTGCGACCCTTCGGCGCCGGCTTTAGATTCCTGCCGACGTCGGTAGAGGAATACAGGGCGGTCCAGGCCTACCTGTCGGAGGCCTCTGCCAGGGATGGTACCATAAAATGGTACTGCTATGCCCTGACAGGGGAGATTCCGACTAAGGTGGCTGTCCGGGGCCTCCCTGCCGATACTGACGCGGCAGAAGTAACCGATGCCCTGAAGGAGCTGGGGTTTCCGGCTCGTCACGCCAGGTGCATCAGGTCCCAGAGAGGGCGCCCGGGCTGCGTGTTTCACGTAGCCTTGGACCACCTCTCGAAGGACGACCTCGCCCGCCTGTACGCAGTCAATGAACTGCTGTACTTGCCGGGGGTGACGATTGAGGGATGGCGACCAACCCGCGGGCCTGCGCAGTGTCATCGCTGCCAGGCCTTCGGGCACGCCTCCAATAATTGTCACCGAGCGGTCCGCTGCGTTCGATGTGCTGGGGAGCATGTCGTAGCGGACTGCCCGAGGCCGAGGGACGGCCCATTCTCCTGCGCCAATTGCGGGAAAGATCACGCTGCCGTCGACAGGCGGTGCGCGGTCTACCGCAAGAGGGCCAGGATGATGGGAGTAACCGTCCCTCCTCCTGCGCCGTTGGTGCCTCGATCCGGGAACACAGCTCCTCCTTCTGTAGCTCCCATTCCGAAGGGGAAGGGGAAAGGGAAAGGGAAATCCTCCCAGCCCCAGCCCCCTCCCCCGTCCTCACCCATCCCCCCTGCCGTGTCAGTGGAGGCCAATCCATCAGCGGCAACGCTGATGGCAGAGGCCAACGCTCCGCGGCGGGGTATACCTGTTCCTACCCCTCGTGGTTCACACGCTGTTAGATTGCCCCATCCTAATAGCAGTGTTCCAGCTCGTGCTGGAACTCAAGTCCCACAATTATCAGGTCCCAAACAAAAAAAAAATCGATTAAAAAAATTAAAAAAAAATTTAAGGAAGAGAGCCCAACGGGATGCAGTGGTGAGTGCTCCTACTGCACCGGCTCCCGCGGCTCCCTTAACAATGGAGGTGGACGTGAACCCACCCATCGACCCAACTTCTCAACCGACTTCACAATCGGGAACGACCCCACTGCCCCAGGCCCAACCAGCCATCTCGGGCACATCTCAGCCCCCCCTCCCCCCCCCGCCCTCAGCGCGAGCGCCGCAGCGGTCGGCAGGCCTCCCAGCCTGCCGGCTTTGCTGCATGGCTGCTGGCGCTCTGGGAAAACTTGGCCGAGTACAACCCGAGGTTGTGCTCCTGGGCGAGACCAAGCTACGTCCTCAGGATGCGTTCAGGATTCCAAACTACTTCATGTACCGACGTGACGAGCTTACCCCTGCCGGGCGGCCGTTCAGGGGCACTGCGGCCCTCGTCAGGCGGGACGTGGTGCATGATCAGTTGGATTTGCTGTCCTTCACATCGACAAGGTCGGTCGGTGTGAGGGTACACACCTCTGGGGGGGATATGCGGATTTATGCCGCGTATAGACCCCCGGGGCCTGAATTTCACCCTGAGGACATAAGACGGGCCCTGAATCACGACAGCCGCCCAGCTCTGCTGGTCGGGGACCTCAACGCGAAGCACGTCGCGTGGGGCTCCCGACTTAACTCAGCAGTGGGCAGGCGGCTGTTAGAAGATGCCGATAGGGGCGACTACTCCGTGGTCGGCCCCGACGAACCCACACACGTCCCGACCGCCGCGCGCTATCAGCCCGATGTGCTGGACGTGTGTGTGCACAAGGGGCTACGGTGCCCCGTAACGATCGAGGCACTGATAAAGCGCGAGCTTAATGAACTGGAAGCGGAGCTGGCGACAAAGATTAGCACCTTCCGGGGCTATGCCTGGCAGGAGAGGATCGAGGAGGCCCGCGAGGACCCCTCCTCAGTATCCCTCCACCGGCTTTGTCGCCAGCTCTCAAATCGGCCTGCCCCGACTTGTCTACTCGTGGACGAGAGGGGCAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATGTCCTGGCCGAAATGCTGGAGCGGCAGTTCGCTCCTAATGACTCTGCACCCTCAGAGGCCGCATTCCACCAATCGGTGGAAGAGAGCGTAGCAAGCCTACTCTCCTCCCCGGTGCCACCGTTGGGAGATGGTGATCTCATCACTCCCAGCGAATTGCGCCTCATCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGCGAGGACGGTATTCCCTCCCTCGCTTTTTTCCACTTCCCTGAAATGGTCGTGTCATGTATGACACGGCTGTTCAACTCCATTCTGTCCACAGGACACTTCCCGGGAATTTGGAAATTGGGCAAGGTTATCGCCTTGCCCAAACCCGGCAAGGACAGGAGAAATCCCTCCAGTTACCGTCCGGTCACGCTGCTGTCGCACGTGGGCAAGTTGTTCGAGCGGCTGCTGCTGAGAAGGATGTCGCCGCACATCCTTCTCAGACCCGAGCAATTCGGGTTTCGTAGCGGTCACTCGACAACGCTGCAATTGGTCCGCATCATGCATCACTTGGCGGATCGGACCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGACATCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGATCCACAAGCTGTTGCAGAACACGGACCTCCAGCACGCCTACGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCCTTGTCGCGGTCGAGGGCGCCAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCGCAGGGGAGCGTCCTGGCACCATTCCTCTACGCTCTCTATACCAACGATATTCCCACGCTCGAGGGCAACCTCGAAGCCTGGGAAGCCGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCGCGTCATCCAACTTCCCCTCTGCGGCCATTTCGAGGATGCAGAGGTTATTGGACTTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACCGCGGCTATCCTCTTCGGTCCGGTCCGCACAAGAGTCGTCCCGGGACAGCTCAGTCTCCGTGGCGCTAATGTCGAGTTTAGATCCAGCGTCCGGTACTTGGGGGTCGATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAATAAGGCGTTGGCGGCCGCTCGCTACGCGAGATTCCTCCTCCGGCCGGTGTTGGCCTCCAGGTTTCCGGTCAGGACTAAGCTCGGCATTTATAAGACGTATGTCCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGGTCACGCGGGTGAAGTTACAGGCCCAGCAGAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGTAATGCCGTAATCGCCCGGGATCTGGATGTGGAGTCGCTCGAGGAGTTCATCCGGAGGCTAGCTCGTAATCTTTACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATTTAGCTCCCTTGCACGCTAGACCACCTGATGGTCTGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGAACTGTCGCAAATACAAATCTAAGATAAGGATGAATCGCATTAAGACTGGTGGTAGTATTGCTGAATAA
Protein
MAARPSIPSTQRPSQSSHVPLPRPKGRAQEELRRHPPIMVEALPNWSRHMAAIRERLGRAPSVRPFGAGFRFLPTSVEEYRAVQAYLSEASARDGTIKWYCYALTGEIPTKVAVRGLPADTDAAEVTDALKELGFPARHARCIRSQRGRPGCVFHVALDHLSKDDLARLYAVNELLYLPGVTIEGWRPTRGPAQCHRCQAFGHASNNCHRAVRCVRCAGEHVVADCPRPRDGPFSCANCGKDHAAVDRRCAVYRKRARMMGVTVPPPAPLVPRSGNTAPPSVAPIPKGKGKGKGKSSQPQPPPPSSPIPPAVSVEANPSAATLMAEANAPRRGIPVPTPRGSHAVRLPHPNSSVPARAGTQVPQLSGPKQKKNRLKKLKKNLRKRAQRDAVVSAPTAPAPAAPLTMEVDVNPPIDPTSQPTSQSGTTPLPQAQPAISGTSQPPLPPPPSARAPQRSAGLPACRLCCMAAGALGKLGRVQPEVVLLGETKLRPQDAFRIPNYFMYRRDELTPAGRPFRGTAALVRRDVVHDQLDLLSFTSTRSVGVRVHTSGGDMRIYAAYRPPGPEFHPEDIRRALNHDSRPALLVGDLNAKHVAWGSRLNSAVGRRLLEDADRGDYSVVGPDEPTHVPTAARYQPDVLDVCVHKGLRCPVTIEALIKRELNELEAELATKISTFRGYAWQERIEEAREDPSSVSLHRLCRQLSNRPAPTCLLVDERGNRCFSAQARADVLAEMLERQFAPNDSAPSEAAFHQSVEESVASLLSSPVPPLGDGDLITPSELRLIIKRMKRRKAPGEDGIPSLAFFHFPEMVVSCMTRLFNSILSTGHFPGIWKLGKVIALPKPGKDRRNPSSYRPVTLLSHVGKLFERLLLRRMSPHILLRPEQFGFRSGHSTTLQLVRIMHHLADRTNARQYTAAVFLDIEKAFDRVWHAGLIHKLLQNTDLQHAYVRLLGSYLEGRSFLVAVEGAKSSVRPVTAGVPQGSVLAPFLYALYTNDIPTLEGNLEAWEADVKLALFADDSAYFASSNFPSAAISRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTRVVPGQLSLRGANVEFRSSVRYLGVDIDRSLRMTAHANKALAAARYARFLLRPVLASRFPVRTKLGIYKTYVRSRITYAAAAWYHLIPQVTRVKLQAQQNLALRTIVGAGRYVSNAVIARDLDVESLEEFIRRLARNLYERADGGPHEHLHNLAPLHARPPDGLALPRELLEPPAMNCRKYKSKIRMNRIKTGGSIAE

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=8.97568e-05,     Score=114

Ontologies

Topology

Length:
1266
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00928
Exp number, first 60 AAs:
1e-05
Total prob of N-in:
0.00005
outside
1  -  1266
 
 

Population Genetic Test Statistics

Pi
15.799259
Theta
20.517509
Tajima's D
-1.509127
CLR
368.262414
CSRT
0.0570471476426179
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号