SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11930
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Full name
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.975
 

Sequence

CDS
ATGCGGGTTTATGCCGCGTATAGACCCCCGGGGCCTGATTTTCACCCCGGGGAAATAAGACGGGTCCTGAATTGCGACAGCCGCCCAGCTCTGCTGGTCGGGGACCTCAACGCGAAGCACGTCGCGTGGGGCTCCCGACTGAACTCAGCAGTGGGCAGGCGGCTGTTAGAAGATGCCGATAGGGGCGACTACTCTGTGGTCGGCCCCGACGAACCCACGCACATTCCGACCGCCGCGCAACTCCAGCCCGACGTGTTGGATGTGTGCGTTCATAAGGGGCTACGGTGCCCCTTAACTATTGAGGCACTGTACGACCTGGGTACCCCCCATCTCCCTATCCTGGTGACACTGGGAATGGGGCTCACCCGGGTTGCGACCTCGCCCCTACGACCGAAGGTCGACTGGGAGCTCTTTAAGAGACGCCTAGTCGACCTTCCCGCAATTCAGGACCCCAACACCCCTGAGGGGGTCGACGACGCGGCAGTCCGCCTTGTCGACTCCATCAGGGGAGCGATCGACCAGGCGACGACTCTTGTGCCCAGCGGCGGGCCCAGAGGTATACTCCCGGCCCATCTGAAAGCGATTATTCGCCGGAAGAGGGGCCTGAGGAGGCTCTGGGCGACAACTCGTTGTCCCAGGATCAAGCGCGAGCTTAATGAGCTGGAAGCGGAGTTGGCGGCGAAGATTAGCTCCTATCGGGGCTATGCGTGGGAGGAACGGATCGATGAGGCCCGTGAGGACCCCTCGTCCGTGTCCCTCCACCGACTTTGCCACCAGCTCTCAAATCGGCCTTCCCCGACTTGTCCACTCGTGGACGAGAGGGGTAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATGTCCTGGCCGTAATGCTGGAGCGGCAGTTCGTTCCAAACAACTCTGTACCCTCAGAGGCCGCATTCCACCAATTGGTGGAAGAGAGCGTAGCAAGCCTACTCTCCTCCCCGGTGCCACCGTTGGGAGATGGTGATTTCATCACTCCCAGTGAATTGCGCCTCTCCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGCGAGGACGGTATTCCCTCCCTCGCATTTTTCCACTTCCCCGAAACGGTCGTGTCATCCATGACGCGACTGTTCAATTCCATTCTGTCCACAGGACACTTTCCGGGAACTTGGAAATTGGGCAAGGTTATTGCCCTGCCCAAACCCGGCAAGGATAGGAGAAATCCCTCCAGTTATCGTCCGATCACTCTGCTGTCGCATATGGGCAATTTGTTCGAGCGGCTGCTGCTGAGAAGGGTGTCGCCGCACATCCTTCTCAGACCCGAGCAATTCGGGTTTCGCAGCGGTCACTCGACAACGCTGCAATTGGTCCGCGTTATGCACCACTTGGCGGATCGGTCCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGATATCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGATCTACAAGCTGTTGCAGAACACGGACCTCCAGCACGCCTATGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCCTTGTCGCGGTCGAGGGCGCAAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCCCAGGGAAGCGTCCTGGCACCAGTCCTCTACGCTCTCTACACCAACGACATTCCCACGCTTGAGGGCAACCTCCAAGCGTGGGAAGCCGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCTCGTCCTCTAATTTCCCCTCTGCGGCCATTTCGAGGATGCAGAGGCTGTTGGACCTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACCGCGGCTATCCTCTTCGGTCCGGTCCGCACAAGAGTCGTCCCAGGACAGCTCAGTCTCCGTGGAGTCAATGTCGAGTTTAGGCCCAGTGTCCGATACCTGGGAGTCAATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAAGTCGGCGTTGGCGGCCGCCCGCTATGCGAGGTTTCTCCTCCGGCCGGTGTTGGCCTCCAGGTTGCCGACCAGGACTAGACTCGGCATTTACAAGACGTATGTTCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGATCATGCGGGTGAAGTTACAGGCCCAGCAGAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGAAATGACGTAATCGCCCGGGATCTAGATGTGGAGTCGCTCGAGGAGTTCATCCGGAGGCTAGCTCGTAATATGTACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTCGGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGGTAAGATAG
Protein
MRVYAAYRPPGPDFHPGEIRRVLNCDSRPALLVGDLNAKHVAWGSRLNSAVGRRLLEDADRGDYSVVGPDEPTHIPTAAQLQPDVLDVCVHKGLRCPLTIEALYDLGTPHLPILVTLGMGLTRVATSPLRPKVDWELFKRRLVDLPAIQDPNTPEGVDDAAVRLVDSIRGAIDQATTLVPSGGPRGILPAHLKAIIRRKRGLRRLWATTRCPRIKRELNELEAELAAKISSYRGYAWEERIDEAREDPSSVSLHRLCHQLSNRPSPTCPLVDERGNRCFSAQARADVLAVMLERQFVPNNSVPSEAAFHQLVEESVASLLSSPVPPLGDGDFITPSELRLSIKRMKRRKAPGEDGIPSLAFFHFPETVVSSMTRLFNSILSTGHFPGTWKLGKVIALPKPGKDRRNPSSYRPITLLSHMGNLFERLLLRRVSPHILLRPEQFGFRSGHSTTLQLVRVMHHLADRSNARQYTAAVFLDIEKAFDRVWHAGLIYKLLQNTDLQHAYVRLLGSYLEGRSFLVAVEGAKSSVRPVTAGVPQGSVLAPVLYALYTNDIPTLEGNLQAWEADVKLALFADDSAYFSSSNFPSAAISRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTRVVPGQLSLRGVNVEFRPSVRYLGVNIDRSLRMTAHAKSALAAARYARFLLRPVLASRLPTRTRLGIYKTYVRSRITYAAAAWYHLIPQIMRVKLQAQQNLALRTIVGAGRYVRNDVIARDLDVESLEEFIRRLARNMYERADGGPHEHLHNIAPLHARPPDGRALPRELLEPPAMVR

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
RSAL01000708    RVE41206.1    NWSH01000895    PCG73652.1    ABLF02008153    ABLF02008462    + More
ABLF02008464    ABLF02034467    GEZM01008457    JAV94772.1    ABLF02041767    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02028535    ABLF02028545    ABLF02023911    ABLF02017815    ABLF02042518    ABLF02057746    NEVH01017470    PNF24199.1    GALX01005299    JAB63167.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    NEVH01021205    PNF19912.1    NEVH01011985    PNF31054.1    GFTR01008279    JAW08147.1    KK119261    KFM75202.1    ABLF02055645    GEZM01074951    JAV64378.1    ABLF02008463    ABLF02021177    ABLF02027367    ABLF02066338    GEZM01053022    JAV74219.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GBBI01004395    JAC14317.1    GFTR01008262    JAW08164.1    NEVH01026386    PNF14434.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GGMS01017914    MBY87117.1    NEVH01008277    PNF34262.1    NEVH01016340    PNF25410.1    NEVH01007402    PNF35856.1    KQ459265    KPJ02064.1    NEVH01015305    PNF27092.1    NEVH01021925    PNF19341.1    NEVH01023979    PNF17579.1    NEVH01001347    PNF42959.1    ABLF02017813    NEVH01014858    PNF27387.1    ABLF02025082    ABLF02039175    ABLF02041809    NEVH01019964    PNF22161.1    NEVH01007838    PNF34986.1    NEVH01006736    PNF36716.1    NEVH01005277    PNF39135.1    NWSH01000032    PCG80496.1    NEVH01002716    PNF41415.1    NEVH01006754    PNF36554.1    GFTR01008038    JAW08388.1    ABLF02050434    ABLF02064867    AB018558    BAA76304.1    GGMR01004661    MBY17280.1    GBBI01004571    JAC14141.1    GFXV01000908    MBW12713.1    KQ971729    KYB24751.1    GALX01005359    JAB63107.1    AB055391    BAB21761.1    KQ973342    KXZ75569.1    GGMR01003864    MBY16483.1    ABLF02041861    NEVH01020940    PNF20481.1    GGMR01003407    MBY16026.1    GFTR01008246    JAW08180.1    NEVH01002556    PNF42024.1    NEVH01022639    PNF18527.1    AF081103    AAC72921.1    ABLF02029306    ABLF02029314    ABLF02060138    GFTR01008254    JAW08172.1    GBBI01003810    JAC14902.1    GGMS01017365    MBY86568.1    GBGD01000415    JAC88474.1    ABLF02008677    ABLF02011967    ABLF02052409    ABLF02056408    NEVH01016302    PNF25823.1    GGMR01012283    MBY24902.1    GBBI01003747    JAC14965.1    GGFL01004957    MBW69135.1    GGMR01019198    MBY31817.1    KU543687    AMS38379.1    NEVH01006721    PNF37225.1    GGMR01020516    MBY33135.1    U07847    AAA17752.1    M22874    M38643    GBGD01000389    JAC88500.1    GGMS01006359    MBY75562.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    KQ973363    EFA13335.2    GFTR01007997    JAW08429.1    GGFL01005012    MBW69190.1    GEZM01084969    JAV60363.1    NEVH01023280    PNF18085.1    GGMS01000737    MBY69940.1    GGMR01000676    MBY13295.1    GBHO01008295    JAG35309.1    GFDL01000004    JAV35041.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF07727   RVT_2
PF03184   DDE_1
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR004875   DDE_SF_endonuclease_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.000272896,     Score=108

Ontologies

Topology

Length:
803
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.07449
Exp number, first 60 AAs:
0.00017
Total prob of N-in:
0.00227
outside
1  -  803
 
 

Population Genetic Test Statistics

Pi
264.497912
Theta
162.461087
Tajima's D
1.75602
CLR
0.068028
CSRT
0.843957802109894
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号