SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11205
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Full name
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.932
 

Sequence

CDS
ATGGCTAGCCAGGAACTGCGCATCATTTATTGGAACCCCGGCGGGGTAAAACCCCGCAAGAACGAGCTCTTGGTTCTCGCCCGGGAGTACAACCCTGAGGTTGTGCTCCTGGGCGAGACCAAGCTACGTCCTCGGGATGTGTTCAGGATTCCAAACTACTTCATGTACCGACGTGACGAGGTGAGTCCTGCCGGGACGCCGTTCAGGGGCACTGCGGCGCTCGTCAGGCGAGACGTGGTGCATGATCAGTTGGATTTGCTGGCCTTCACATCGACAAGGTCGATCGGTGTGAGGATCCACACCTCGGGGGGAGATATGCGGGTTTATGCCGCGTATAGACCCCCGGGGCCTGATTTCCACCCCGGGGACATAAGACGGGTCCTGAATTGCGACAGCCGCCCAGCTCTGCTGGTCGGGGACCTCAACGCGAAGCACGTCGCGTGGGGCTCCCGACTGAACTCAGCAGTGGGCAGGCGGCTGTTAGAAGATGCCGATAGGGGCGACTACTCTGTGGTCGGCCCCGACGAACCCACGCACATTCCGACCGCCGCGCAACTCCAGCCCGACGTGTTGGATGTGTGCGTTCATAAGGGGCTACGGTGCCCCTTAACTATTGAGGCACTGTACGACCTGGGTACCCCCCATCTCCCTATCCTGGTCACACTGGGAATGGGGCTTACCCGGGTTGCGACCTCGCCCCTACGACCGAAGGTCGACTGGGAGCTCTTTAAGAGACGCCTAGTCGACCTTCCCGTAATTCAGGACCCCAACACCCCTGAGGGGGTCGACGACGCGGCAGTCCGCCTTGTCGACTCCATCAGGGGAGCGATCGACCAGGCGACGACTCTTGTGCCCAGCGGCGGGCCCAGAGGTATACTCCCGGCCCATCTGAAAGCGATTATTCGCCGGAAGAGGGGCCTGAGGAGGCTCTGGGCGACAACTCGTTGTCCCAGGATCAAGCGCGAGCTTAATGAGCTTGAAGCGGAGTTGGCGGCGAAGATTAGCTCCTATCGGGGCTATGCGTGGGAGGAACGGATCGAGGAGGCCCGTGAGGACCCCTCGTCCGTGTCCCTCCACCGACTTTGCCGCCAGCTCTCAAATCGGCCTGCCCCGACTTGTCCACTCGTGGACGAGAGGGGCAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATGTCCTGGCCGTAATGCTGGAGCGGCAGTTCGCTCCAAATAACTCTGCACCCTCAGAGGCCGCATTCCACCAATCGGTGGAAGAGAGCGTAGCAAGCCTACTCTCCTCCCCGGTGCCACCGTTGGGAGACGGTGATTTCATCACTCCCAGTGAATTGCGCCTCTCCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGCGAGGACGGTATTCCCTCCCTCGCATTTTTCCACTTCCCCGAAACGGTCGTGTCATTCATGACACGACTGTTCAATTCCATTCTGTCCACAGGACACTTCCCGGGAATTTGGAAATTGGGCAAGGTTATTGCCCTGCCCAAACCCGGCAAGGATAGGAGAAATCCCTCCAGTTATCGTCCGATCACTCTGCTGTCGCATATGGGCAAGTTGTTCGAGCGGCTGCTGCTGAGAAGGGTGCCGCCGCACATCCTTCTCAGACCCGAGCAATTCGGGTTTCGCAGCGGTCACTCGACAACGCTGCAATTGGTCCGCGTTATGCACCACTTGGCGGATCGGTCCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGATATCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGATCTACAAGCTGTTGCAGAACACGGACCTCCAGCACGCCTATGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCCTTGTCGCGGTCGAGGGCGCAAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCCCAGGGAAGCGTCCTGGCACCAGTCCTCTACGCTCTCTACACCAACGACATTCCTACGCTTGAGGGCAACCTCCAAGCGTGGGAAGCCGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCTCGTCCTCTAATTTCCCCTCTGCGGCCATCTCGAGGATGCAGAGGCTGTTGGACCTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACCGCGGCTATCCTCTTCGGTCCGGTCCGCACAAGAGCCGTCCCAGGACAGCTCAGTCTCCGTGGAGTCAATGTCGAGTTTAGGCCCAGTGTCCGATACCTGGGAGTCAATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAAGTCGGCGTTGGCGGCCGCCCGCTATGCGAGGTTTCTCCTCCGGCCGGTGTTGGCCTCCAGGTTGGGAGCTACTGGAACCCCCGGCTATGGTAAGATAGTCGGCTTAACCGGAGTGATATGGGAGTGCTCATAA
Protein
MASQELRIIYWNPGGVKPRKNELLVLAREYNPEVVLLGETKLRPRDVFRIPNYFMYRRDEVSPAGTPFRGTAALVRRDVVHDQLDLLAFTSTRSIGVRIHTSGGDMRVYAAYRPPGPDFHPGDIRRVLNCDSRPALLVGDLNAKHVAWGSRLNSAVGRRLLEDADRGDYSVVGPDEPTHIPTAAQLQPDVLDVCVHKGLRCPLTIEALYDLGTPHLPILVTLGMGLTRVATSPLRPKVDWELFKRRLVDLPVIQDPNTPEGVDDAAVRLVDSIRGAIDQATTLVPSGGPRGILPAHLKAIIRRKRGLRRLWATTRCPRIKRELNELEAELAAKISSYRGYAWEERIEEAREDPSSVSLHRLCRQLSNRPAPTCPLVDERGNRCFSAQARADVLAVMLERQFAPNNSAPSEAAFHQSVEESVASLLSSPVPPLGDGDFITPSELRLSIKRMKRRKAPGEDGIPSLAFFHFPETVVSFMTRLFNSILSTGHFPGIWKLGKVIALPKPGKDRRNPSSYRPITLLSHMGKLFERLLLRRVPPHILLRPEQFGFRSGHSTTLQLVRVMHHLADRSNARQYTAAVFLDIEKAFDRVWHAGLIYKLLQNTDLQHAYVRLLGSYLEGRSFLVAVEGAKSSVRPVTAGVPQGSVLAPVLYALYTNDIPTLEGNLQAWEADVKLALFADDSAYFSSSNFPSAAISRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTRAVPGQLSLRGVNVEFRPSVRYLGVNIDRSLRMTAHAKSALAAARYARFLLRPVLASRLGATGTPGYGKIVGLTGVIWECS

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
RSAL01000708    RVE41206.1    NWSH01000895    PCG73652.1    ABLF02008153    ABLF02008462    + More
ABLF02008464    GEZM01008457    JAV94772.1    ABLF02023911    GGMR01004661    MBY17280.1    ABLF02034467    NEVH01017470    PNF24199.1    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    NEVH01011985    PNF31054.1    NEVH01021205    PNF19912.1    NEVH01005277    PNF39135.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GALX01005299    JAB63167.1    ABLF02042518    ABLF02057746    GFTR01008279    JAW08147.1    ABLF02028535    ABLF02028545    GBBI01004395    JAC14317.1    NEVH01006736    PNF36716.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    NEVH01007402    PNF35856.1    NEVH01026386    PNF14434.1    ABLF02008605    ABLF02008608    ABLF02008609    ABLF02008610    ABLF02017023    GGFL01004957    MBW69135.1    GFTR01007929    JAW08497.1    NEVH01008277    PNF34262.1    NEVH01023979    PNF17579.1    NEVH01021925    PNF19341.1    NEVH01015305    PNF27092.1    NEVH01001347    PNF42959.1    NEVH01016340    PNF25410.1    NEVH01016302    PNF25823.1    ABLF02041767    GGMS01002992    MBY72195.1    KK119261    KFM75202.1    LBMM01018163    KMQ83860.1    GBGD01000389    JAC88500.1    KK118005    KFM71947.1    GGMR01003407    MBY16026.1    GGMS01017365    MBY86568.1    NWSH01007753    PCG62823.1    GFTR01008254    JAW08172.1    GBBI01004571    JAC14141.1    GBGD01000415    JAC88474.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GGMR01012443    MBY25062.1    GFXV01000908    MBW12713.1    M22874    M38643    GALX01005359    JAB63107.1    GFTR01008269    JAW08157.1    NWSH01000032    PCG80496.1    NEVH01023280    PNF18085.1    GBBI01003747    JAC14965.1    GEZM01084969    JAV60363.1    KQ973342    KXZ75569.1    NEVH01002556    PNF42024.1    AB055391    BAB21761.1    AB018558    BAA76304.1    GFTR01008246    JAW08180.1    GBBI01003810    JAC14902.1    GGMS01002786    MBY71989.1    GGMR01013409    MBY26028.1    GFTR01008260    JAW08166.1    GFDL01000006    JAV35039.1    KU543687    AMS38379.1    GFTR01008271    JAW08155.1    KK113281    KFM59799.1    GDHC01020244    JAP98384.1    GGMR01000226    MBY12845.1    ABLF02017813    GGMR01012283    MBY24902.1    NEVH01005295    PNF38784.1    M95171    AAA29354.1    M91082    AAA28291.1    KF280391    AIE77315.1    M17214    AAA28508.1    GGMR01016296    MBY28915.1    GGMR01000676    MBY13295.1    GFTR01008038    JAW08388.1    GFDL01000004    JAV35041.1    GGMR01012676    MBY25295.1    U07847    AAA17752.1    GGFJ01001844    MBW50985.1    GGMR01003864    MBY16483.1    GGMR01002322    MBY14941.1    GGFJ01001842    MBW50983.1    GGFJ01001843    MBW50984.1    KK119692    KFM76444.1    GFXV01002840    MBW14645.1    LBMM01015125    KMQ84919.1    GEHC01000978    JAV46667.1    AY180919    AAN87272.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF07727   RVT_2
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.000880466,     Score=104

Ontologies

Topology

Length:
811
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.16861
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00046
outside
1  -  811
 
 

Population Genetic Test Statistics

Pi
347.485524
Theta
161.530635
Tajima's D
3.695526
CLR
0.270865
CSRT
0.996850157492125
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号