SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO11011
Annotation
S08405_hypothetical_protein_2_-_silkworm_transposon_mag
Location in the cell
Nuclear   Reliability : 3.014
 

Sequence

CDS
ATGTCGGTCGGGCAGTTGAAAGAATTCGCGGTAAACAGTGGAAATTGGTCCTCATATGTTGAGAGATTAGAAATGTACTTCTTGGTGAATAAAGTGACTGACGATTTAAAATTACCCACATTAATTTCCGTTATGGGTGAGGAAGCGTACGATTTATTATCGACATTAGCCAGCCCTTCGAAGCCGTCACAGTTAACTTATGCTAATGCCGTGGCGATGTTGGCAGCTCACCTGCAACCGAAGCCCTCAATCTTGGCGGAAAGATACAAGTTTCGACAACGTCGGCAGCTGAATGAGTCAATAGCTGACTACCTCACAGAATTAAAAAAATTATCAAAAAATTGTGAATTCGGCTCGTCGCTGGATGAAAATCTGCGTGATCAAATGGTTTGTGGATTAAAGAGCGAAATCATACGGCAAAGGTTATTTGCCGAGGAGAAATTAGAATATAAGCGAGCAGTTACGTTAGCTTTGTCTTTAGAAGCTGCGGAGAGGGATGCGATTGCAGTGGAACGTACGCCAATTGAGGAGGTTAACAAAATTAACTTCAATGAATGTTCAAGATGTGGAGACAGGAGACACCAAGCAAAGGATTGCATATACAAAGACTACGTGTGCAGTTCATGTCATGAAACCGGCCATCTACGAAGAATGTGCCCCAAAAAAGGGCTTAAGAACCAGGCGGAGGCAGCCGGGGGTTCACCATGCACCGGGCGCCGGGGGAACCGGGGTGCAGGCGGCAACAGGCGATCGTGGCGCGGGCAGCGCGGTGCGGGACGAAGAGGCCGAGAGCGGGCTCCTTTGCACTTAGTCTTATTATACGATCAAAACAACGATGACACATACAACAACTTCAATAATGAACAGGACGGGTGTGGAGAAGAAAATGAGCCTATGTACCAAATGACATTGAGTAATTATAAACCGTCAGTGTGTGCCCAAAGTGCGAGTGTTCTATCTAGCGGTGTTGTTTCGGCGCGGAGACGTTCCGAGCAACGTAACGCAGGACCCGGGACCAGCACCCCCGGCCCGTCCCGCAAGGGACGTCAAGTTATGTCGAGTCTAAGATTCAGACCAGCACCAGCAACCCGTACAGTCTCGATGGGACTCGGGACAGACAGCCGGCCCGGGCCTCCGGTCGCGGCCCAGAGGACTCCGAGGATCGAACCGGAGGAAGATGTCCTTCCCCCGTTGACCGATCCCTCTGGGCCCCCTCGGCCGCGGAAGAAGGCCAGGTCCGAGTCTGACCGAGGCTCATCGAGCGAAAAGGACAAGCGTCCTAGAATAGGCCCCTCATCTAGATCGGAAGGAGAGGAAAGTGCGACCACATCCTCTGCACACTCCTCAACCGAATCGGTCACTCCTTCCTCAACTAGGTCTTCGTCCCCCTCTGGGAGTCCAATCCCAGCCCAACCAATTCCGAAGCCTAGGGCTCCCGCCAGGACAGGGATAGCCCCAAGGCAAGTAAGATCCCCTCCTCGCTCTCCTTCCCCAACGCTGTCTCCAATCCCGGTAGACTCAACTCGAGGTGCCCCCGCCCTAAGCGGCACGGCGGGCAACCTGGACTCGACCAGGTACATGGACCTCGAGTCTACCAGACCTCAACAAGTCACTAAGCCCAACCCCACTCCCTCCACCTCCTATGCTGCCATGGCAGCTAGGCCAGGTATCCCTACCGCCCAGAGGACTTCCCAATCCTCACGAGTCCCTCCCCCGAGGCCGAAGGGTCGCGCCCAGGAGGAACTGCGCCGACACCCGCCAATTATGGTGGAGGCCCTTCCAAATTGGTCCCGCCACATGGCGGCCATAAGGGAGCGCCTAGGCCGCGCCCCCTCGGCGCGACCCTTCGGCGCCGGCTTTAGATTTCTGCCGACGTCGGCTGAGGAGTATAGGGCGGTCCAGGCCTACCTGTCGGAGGCCTCTGCCAGGGACGGTACCATTAAATGGTACTGTTACGCCCTGGCGGAGGAGATGCCTTCGAAGGTGGCAGTCCGGGGCCTCCCTGCCGACACCGACGAGGCAGAAATAGTCAATGCCCTGAAGGAGCTGGGATTCCCGGCTCGATACGCCAGGTGCATTAGGTCCCGGAGAGGGCGTCCGGGCTGCGTTTTTCACGTAGCCCTGGACCACCTCTCGAAGGACGACCTCGCCCGCTTGTACGCAGTCAACGAACTGCTGTACCTGCCGGGGGTGACGGTCGAAGGATGGCGTCCAATCCGAGGGCCTGCGCAGTGTCATCGCTGCCAGGCCTTCGGACACGCCTCCTACAACTGTCATCGCGCGGTCCGTTGCGTAAGGTGTGCCGGGGAGCACATCGTAGCGGACTGCCCGAGGCCGAGGGACGGCCCGTTCTCCTGTGCCAACTGCGGGAAGGACCACGCCGCCGTCGACAGACGGTGTGCGGTCTTCCGCAAACGGGCCAGGATGATGGGAGTAACCGTCCCCCCTCCTGCACCACTGGCGACTCGAGCCGGGAGTGCAGCTCTTCCGGCTTCAATACCTGTAGCAAAGGGGAAGGGGAAGGGGAAAGGGAAAACTTCCCAGCCCCCTCCCCCATCCCACTCCGCTCCGTCTGCTGTGGTGGTGGAGGCACTGCCATCGGCGCCTACGCTGATGGCACAGGCCAACCCACCACGGCAGATAAATAAACCCAAACCCACTCCTGCTCCCCGTGGTCGTACATCTGCTGGTATATCAGTGCCTAAACCACTCCCGACTAGCGGCCCTACGTCCACTAAAAGGGAGAAGAACAAGAGGAAAAAGGCCAAAAGGAAAACAAGAAAAAGGGAAGAAAGTGAGAGACTAAGGGGTACATCTGAGCCCACAGTGCCAGAACCCCAACAAACCAACATAGAAACTATGGAGGTCTCCGAGGCCCCCCTTACTGCCCAACAACCGACATCAAGCCAACCACTGCCTACAGCCCATCCGGCCGAAGGCAAGCACGACTTGAACAACCAGCCCCCCCTCCCCCCCCGCCCTCAGCGCGAGCGCCGCAGCGGTCGACAGGCCTCCCAGCCTGCCGGCTTTGCTGCATGGCTGCTCGCACTGTGGGAGAAATTGTCCGAGGAGCTGCGCATCATTTATTGGAACCCCGACGGGATAAAGTCCCGAAAGAACGACCTGCTTGTTCTCGCCCGGGAGTATAACCCAGAGGTTGTGCTCCTGGGCGAGACCAAGCTACGTCCTCAGGATGCGTTCAGGATTCCAAACTACTTCATGTACCGACGTGACGAGCTTACCCCTGCCGGGCGGCCGTTCAGGGGCACTGCGGCCCTCGTCAGGCGGGACGTGGTGCATGATCAGTTGGAGTTGCTGTCCTTCACATCGACAAGGTCAGTCGGTGTGAGGGTACACACCTCGGGGGGAGATATGCGGATTTATGCCGCGTATAGACCCCCGGGGCCTGAATTTCACCCTGAGGACATAAGACGGGCCCTGAATCACGACAGCCGCCCAGCTCTGCTGGTCGGGGACCTCAACGCGAAGCACGTCGCGTGGGGCTCCCGACTTAACTCAGCAGTGGGCAGGCGGCTGTTAGAAGATGCCGATAGGGGCGACTACTCCGTGGTCGGCCCCGACGAACCCACACACATCCCGACCGCCGCGCGCTATCAGCCCGATGTGCTGGACGTGTGTGTGCACAAGGGGCTACGGTGCCCCGTAACGATCGAGGCACTGTACGACCTGGGTACCCCACATCTCCCTATCCTGGTGACACTGGGAATGGGGCTCACCCGGGTTGCGACCTCGCCCCTACGACCGAAGGTCGACTGGGAGCTCTTTAAGAGACGACTAGTCGACCTTCCCGTGATTCAGGACCCCAACACCCCTGATGGGGTCGACGATGCGGCAACCCGCCTTGTTGACTCCATCAGGGGAGCGATCGACCAGGCGACGACTCTTGTGCCCAGCGGCGGGCCCAGAGGTATACTCCCGGCCCATCTGAAGGCGATTATTCGCCGGAAGAGGGGCTTGAGGAGGCTCTGGGCGACAACTCGTTGTCCCAGGATAAAGCGCGAGCTTAATGAACTGGAAGCGGAGCTGGCGACAAAGATTAGCACCTTCCGGGGCTATGCCTGGCAGGAGAGGATCGAGGAGGCCCGCGAGGACCCCTCCTCAGTATCCCTTCACCGGCTTTGTCGCCAGCTCTCAAATCGGCCTGCCCCGACTTGTCCACTCGTGGACGAGAGGGGCAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATGTCCTGGCCGAAATGCTGGAGCGGCAGTTCGCTCCTAATGACTCTGCACCCTCAGAGGCCGCATTCCACCAATCGGTGGAAGAGAGCGTAGCAAGCCTACTCTCCTCCCCGGTGCCACCGTTGGGAGATGGTGATCTCATCACTCCCAGCGAATTGCGCCTCATCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGCGAGGACGGTATTCCCTCCCTCGCTTTTTTCCACTTCCCTGAAACGGTCGTGTCATATATGACACGGCTGTTCAACTCCATTCTGTCCACAGGACACTTCCCGGGAATTTGGAAATTGGGCAAGGTTATCGCCTTGCCCAAAACCGGCAAGGACAGGAGAAATCCCTCCAGTTACCGTCCGATCACGCTGCTGTCGCACGTGGGCAAGTTGTTCGAGCGGCTGCTGCTGAGAAGGATGTCGCCGCACATCCTTCTCAGACCCGAGCAATTCGGGTTTCGTAGCGGTCACTCGACAACGCTGCAATTGGTCCGCGTCATGCATCACTTGGCGGATCGGACCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGACATCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGATCCACAAGCTGTTGCAGAACACGGACCTCCAGCACGCCTACGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCCTTGTCGCGGTCGAGGGCGCAAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCGCAGGGGAGCGTCCTGGCACCATTCCTCTACGCTCTCTACACCAACGACATTCCCACGCTCGAGGGCAACCTCGAAGCGTGGGAAGCCGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCGCGTCATCCAACTTCCCCTCTGCGGCCATTTCGAGGATGCAGAGGTTATTGGACTTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACCGCGGCTATTCTCTTCGGTCCGGTCCGCACAAGAGTCGTCCCGGGACAGCTCAGTCTCCGTGGCGCTAATGTCGAGTTTAGATCCAGCGTCCGGTACTTGGGGGTCGATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAAATTGGCGTTGGCGGCCGCTCGCTACGCGAGATTCCTCCTCCGGCCTGTGTTGGCCTCCAGGTTGCCGGTCAGGACTAAGCTCGGCATTTATAAGACGTATGTCCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGGCCATGCGGGTGAAGTTACAGGCCCAGCAGAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGTAATGCCGTAATCGCCCGGGATCTGGATGTGGAGTCGCTCGAGGAGTTCATCCGGAGGCTAGCTCGTAATCTTTACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATTTAGCTCCCTTGCACGCTAGACCACCTGATGGTCTGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGTGCGCCGAGACGCGCATAACGAACAGCCCCCCCCCTAGTATAACATCTTGCATCCACATCACCCCTGCCCTGTGTGGCAGGGAGCTTCGTCCCGGGCAGTGGGGATTGCCCCGAGGCCCGTTCCGTACCCCCGAAAGGGGAAATCAGGACCTAGACAGTCATTTAAAGTCTATAAAAGAAGTATTAGATATATTAGAAAGGTATGGCTTAAAAATTAAAAGGAGTAAGTGCGAGTTCATGGTAACAGAAGTGAGGTATTTAGGGTTCATAATAGATCAAAATGGGGTTCGTGTAGACCCAGAGAAAGTCAAATCAATAGCAACAATGCCACACCCAAATAACGTGACAGAATTAAAATCTTTCATCGGTATGGTAAACTTCTATTCGAAGTTCATACAAGATTTGAGTGCACATTTATCACCTTTATATGCCCTTTTAAAAAAAGGTAAGCACTGGATGTGGGGAAATGAACAGAATGCTGCTTTCCTGAATGTTAAAAAGTTTTTGTGTAGTACAAAAGCACTTGCACATTTTGATATGTCTTTGGAGTCGGTGTTGACTGTGGATGCGAGCGCGCGTGGTCTGGGTGCCGTGTTGGCGCAGCGCGGGCCAGGATGTCAGGAGCGCGTCGTTGCATACGCTTCACGCGCACTCACCACTCATGAATTACATTACAGTCAGATTCATAAGGAAGCATTGGCGATTGTTTTCGCGGTGGAAAAATTCCATCAATACTTATATGGGAGAAAGTTCATACTACGGACCGACCACAAACCTCTGGTGAGCATTTTCGGGCCTAACATAGGTATCCCGAGCGCGGCAGCTAGCCCCTTGCAGCGCTGGGCTATCAAACTATCAGCATATGACTTTGAAATCGAGTACGTTAGGACAGATAAAAATGTAGCCGATGCACTTTCACGGTTAATCGAGTCTCAAAAAAATGACGTAGCTTCCGAGGAAACAGACTTACCCGAGCAAACCTACTTACACTTCTCAACAGAAGCTCTGTTAATAGATTATAATGTTCTTAAAAAACAAACTAGTAGTGATCCAATCTTAAGTCGCGTGTTAAGTTATATAAGGGACGGATGGCCCTTAGACATAGAAATTAATGAATTAAAACCATATTATAATAGGAAAAACGAACTTTATATTGAATTAGGATGTATAATGTGGGGTCATCGTGTGGTTATACCCTCTTCATGCAGAAACAAAATAATAACGGAGCTTCATGATCCGCATTTGGGCATAGTGAAAACAAAATCGCTAGCACGTAGTTACGTTTGGTGGCCGGGAATCGACGAAGCGCTCGAGACGGAATGTCGCGCTTGCACCGTGTGTGCTGCCGTCGCAGACGCACCTTCTACACACGCGCCCCGCTCGTGGCCCTGGCCCTCACGCCCCTGGTCCAGGTTACACTTAGACTTCTTAGGCCCCATAGGTGGAGTCACTTATCTAGTTGTAGTGGATTCATGCTCCAAATGGATAGAGGCAATTAAAATGCAGAGGACAACGGCACAAGCGGTTATATCGGTACTGCGGGACTTGTGGTCAAAATTCGGCCTGCCAAAGCAAACGGTCAGTGACAATGGACCGCCTTTCTCGAGCTCTGATTTTCAGAAGTTTCTGATTCATAATGGCATAAAACATATTTATTCAGCTCCCTATCATCCCGCCTCTAATTGGGCCGCTGAAAATGCAGTTAAAATTTGTAAACGTGCGATTAAAAAGGCATTAAAACAGAATTTAAACGTAGATACAGCTCTGTGTAGATTTTTATTAGCCTACAGAAATACAGAACATGCAACTACCGGCGATAGTCCAGCCAATATATTACAGGGTCGAAGTCTCCGTATGAGATTAGATAATTTAAAACCAGAAAGGCAATCTCGAGTTATCGCGCAACAAGAGCGGAGCGAGCAAAACGCAGGGGGTGTGCAGCGACAACTCGAGCCGGGCACTAAGGTGTGGTATCGGGATTATCGAGGTCTGGATAAATGGGTACCTGGGACGATCCTCAAGCAATTAGGTAGTCGTGATTACTGTGTACGATCTAGTTTTGGAACCGAGAATCATAGGCACGTCGATCAGCTAAAATTAAGGGTTACAAAAAATATAGATAAAGTTGATACCTTTGCGTCGATTCGTAAAAATATAAGTCCCGAACTGATCGCGCAAAATTTAGACTTAAGAACACAATCACGTAAGTCGCTATCATTTCCCATGACAAGTGGCGAGGAACCAGTGGCGGTGGTCAACGATTCGGGGAAGAGTAGTTCACCACCAAAAAATAGCACACCGGCACAGGATGCTGTATCGCCTATTCGTGGCAGCCCTATGAGACCCGCTGTGCCGATAGACAAGGCAGCATGTAGTACTGGTGGTAAGAGTATCAATGAAAATGTGACACCCAAACGTGAACGTCCTGTAAGAATACGCAAGCCACCAGTTAGATATGGATTCGAGGAAATAGATTAA
Protein
MSVGQLKEFAVNSGNWSSYVERLEMYFLVNKVTDDLKLPTLISVMGEEAYDLLSTLASPSKPSQLTYANAVAMLAAHLQPKPSILAERYKFRQRRQLNESIADYLTELKKLSKNCEFGSSLDENLRDQMVCGLKSEIIRQRLFAEEKLEYKRAVTLALSLEAAERDAIAVERTPIEEVNKINFNECSRCGDRRHQAKDCIYKDYVCSSCHETGHLRRMCPKKGLKNQAEAAGGSPCTGRRGNRGAGGNRRSWRGQRGAGRRGRERAPLHLVLLYDQNNDDTYNNFNNEQDGCGEENEPMYQMTLSNYKPSVCAQSASVLSSGVVSARRRSEQRNAGPGTSTPGPSRKGRQVMSSLRFRPAPATRTVSMGLGTDSRPGPPVAAQRTPRIEPEEDVLPPLTDPSGPPRPRKKARSESDRGSSSEKDKRPRIGPSSRSEGEESATTSSAHSSTESVTPSSTRSSSPSGSPIPAQPIPKPRAPARTGIAPRQVRSPPRSPSPTLSPIPVDSTRGAPALSGTAGNLDSTRYMDLESTRPQQVTKPNPTPSTSYAAMAARPGIPTAQRTSQSSRVPPPRPKGRAQEELRRHPPIMVEALPNWSRHMAAIRERLGRAPSARPFGAGFRFLPTSAEEYRAVQAYLSEASARDGTIKWYCYALAEEMPSKVAVRGLPADTDEAEIVNALKELGFPARYARCIRSRRGRPGCVFHVALDHLSKDDLARLYAVNELLYLPGVTVEGWRPIRGPAQCHRCQAFGHASYNCHRAVRCVRCAGEHIVADCPRPRDGPFSCANCGKDHAAVDRRCAVFRKRARMMGVTVPPPAPLATRAGSAALPASIPVAKGKGKGKGKTSQPPPPSHSAPSAVVVEALPSAPTLMAQANPPRQINKPKPTPAPRGRTSAGISVPKPLPTSGPTSTKREKNKRKKAKRKTRKREESERLRGTSEPTVPEPQQTNIETMEVSEAPLTAQQPTSSQPLPTAHPAEGKHDLNNQPPLPPRPQRERRSGRQASQPAGFAAWLLALWEKLSEELRIIYWNPDGIKSRKNDLLVLAREYNPEVVLLGETKLRPQDAFRIPNYFMYRRDELTPAGRPFRGTAALVRRDVVHDQLELLSFTSTRSVGVRVHTSGGDMRIYAAYRPPGPEFHPEDIRRALNHDSRPALLVGDLNAKHVAWGSRLNSAVGRRLLEDADRGDYSVVGPDEPTHIPTAARYQPDVLDVCVHKGLRCPVTIEALYDLGTPHLPILVTLGMGLTRVATSPLRPKVDWELFKRRLVDLPVIQDPNTPDGVDDAATRLVDSIRGAIDQATTLVPSGGPRGILPAHLKAIIRRKRGLRRLWATTRCPRIKRELNELEAELATKISTFRGYAWQERIEEAREDPSSVSLHRLCRQLSNRPAPTCPLVDERGNRCFSAQARADVLAEMLERQFAPNDSAPSEAAFHQSVEESVASLLSSPVPPLGDGDLITPSELRLIIKRMKRRKAPGEDGIPSLAFFHFPETVVSYMTRLFNSILSTGHFPGIWKLGKVIALPKTGKDRRNPSSYRPITLLSHVGKLFERLLLRRMSPHILLRPEQFGFRSGHSTTLQLVRVMHHLADRTNARQYTAAVFLDIEKAFDRVWHAGLIHKLLQNTDLQHAYVRLLGSYLEGRSFLVAVEGAKSSVRPVTAGVPQGSVLAPFLYALYTNDIPTLEGNLEAWEADVKLALFADDSAYFASSNFPSAAISRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTRVVPGQLSLRGANVEFRSSVRYLGVDIDRSLRMTAHAKLALAAARYARFLLRPVLASRLPVRTKLGIYKTYVRSRITYAAAAWYHLIPQAMRVKLQAQQNLALRTIVGAGRYVSNAVIARDLDVESLEEFIRRLARNLYERADGGPHEHLHNLAPLHARPPDGLALPRELLEPPAMCAETRITNSPPPSITSCIHITPALCGRELRPGQWGLPRGPFRTPERGNQDLDSHLKSIKEVLDILERYGLKIKRSKCEFMVTEVRYLGFIIDQNGVRVDPEKVKSIATMPHPNNVTELKSFIGMVNFYSKFIQDLSAHLSPLYALLKKGKHWMWGNEQNAAFLNVKKFLCSTKALAHFDMSLESVLTVDASARGLGAVLAQRGPGCQERVVAYASRALTTHELHYSQIHKEALAIVFAVEKFHQYLYGRKFILRTDHKPLVSIFGPNIGIPSAAASPLQRWAIKLSAYDFEIEYVRTDKNVADALSRLIESQKNDVASEETDLPEQTYLHFSTEALLIDYNVLKKQTSSDPILSRVLSYIRDGWPLDIEINELKPYYNRKNELYIELGCIMWGHRVVIPSSCRNKIITELHDPHLGIVKTKSLARSYVWWPGIDEALETECRACTVCAAVADAPSTHAPRSWPWPSRPWSRLHLDFLGPIGGVTYLVVVDSCSKWIEAIKMQRTTAQAVISVLRDLWSKFGLPKQTVSDNGPPFSSSDFQKFLIHNGIKHIYSAPYHPASNWAAENAVKICKRAIKKALKQNLNVDTALCRFLLAYRNTEHATTGDSPANILQGRSLRMRLDNLKPERQSRVIAQQERSEQNAGGVQRQLEPGTKVWYRDYRGLDKWVPGTILKQLGSRDYCVRSSFGTENHRHVDQLKLRVTKNIDKVDTFASIRKNISPELIAQNLDLRTQSRKSLSFPMTSGEEPVAVVNDSGKSSSPPKNSTPAQDAVSPIRGSPMRPAVPIDKAACSTGGKSINENVTPKRERPVRIRKPPVRYGFEEID

Summary

Uniprot
ProteinModelPortal
PDB
4OL8     E-value=3.52084e-29,     Score=327

Ontologies

Topology

Length:
2750
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00994
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00003
outside
1  -  2750
 
 

Population Genetic Test Statistics

Pi
308.570345
Theta
204.490287
Tajima's D
2.30948
CLR
12.07395
CSRT
0.923553822308885
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号