SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10989
Pre Gene Modal
BGIBMGA008516
Annotation
Yokozuna_[Bombyx_mori]
Transcription factor
Location in the cell
Nuclear   Reliability : 4.017
 

Sequence

CDS
ATGAACGAAAATGATGATGAATTGACAACATTTTGTGATTCAACGTCATCGCTTGTTGAGGGATGCCGTCTTCCTGTTCGTATGCAAGGAGGAGACGACTGGCCACTCGCCGAAATTATAAGTATTAAAGAAGTTCAGGGCCAAAGAGGATTTTACGTGCATTATGTTGATTTTAATAAACGTCTCGATGAATGGGTGGGTGAATCTTGGTTGGACACTCGTAAAGTCCAATTCCCTCGACGGGATGGAACAGCAACAGGTGGTACAACTACTCCAAAGAAAACACTCATTGGATCAGGAGGTGGCGTTATGCCTACTTTTATTAATGACACAGTCTGCAATGAGAATCAGAAGTCTAGTAATGCTAGAACTATAACAAATCAACTGACCCAACCCAAAACACATGAAAAGGCCCATTTTAGCAATGCACTCAATGGTTCCGCACAAAAAAATGCACTTGCTGTGGTTGAACCAAGACAGTTGGTGTCCCGACCCGCCAGTCCGACTCTGGTAAATGATTCTTCGTCACTGGTCAATGGAGGAGCTGTCCTCGCAGCAGCCTTACAGAAAAAGATGAACAGAAAACGCAAACCGCCCTCTTTGGATAATGACGTCAGTTTACATTCGGAGCCGTCACAAGAAGGTGAAGCGGACGCGACGGCCAGCGGCACGGCGACGCCGACGGCGCGCCCGCGACAGTCCGGCAGTCTGGTCGCGCACGGACACGACGATCTCGTCACGCGGATGAAGAACATCGAGATGATAGAACTGGGACGGCACAGGATACGACCTTGGTACTTCGCGCCATACCCCCAGGAAATGGTGAATCTCCCTTGCATATACATCTGTGAGTTCTGTTTGAAATATAGGAAAAGCAAAAAATGCCTCGAAAGACACTTGATCAAATGCAAACTAAAACATCCGCCGGGCAACGAGATTTACCGCAAGGGAAGCATATCGTTCTTCGAGATAGACGGACGCAAGAACAAATGCTACGCGCAGAACTTGTGTCTCTTAGCTAAATTATTTCTGGACCACAAAACCTTGTACTACGATACAGACCCTTTCTTGTTTTACGTCATGACCGAATTCGATTCCAGAGGATTCCATATAGTGGGATATTTTTCGAAGGAAAAAGAAAGCACGGAAGACTACAACGTAGCATGTATACTGACACTGCCTCCGTACCAAAGAAAGGGCTATGGAAAATTACTCATAGAATTTAGTTACGAATTGTCAAAGTTCGAAGGTAAAACGGGCTCTCCGGAGAAACCGCTGTCGGACCTAGGACTGTTATCATACAGAAGTTATTGGGCTCAAACCATACTCGATATATTATTGCACATCAAACCTGTAGGCGATAATGAAAAACCGGTAATTACCATAAACACGTGGATATTTCGAATATCATGCATCCTAGAGGAAAAGGAATGCAAAGAAGCAATTGAAGATGGCATAACAGAGGAAATATTGAAGTCAGAAAAATTCAAAAAGAAAGACGCAAAAGCTAGAAGTTTGATAGTCAACTGCCTCTCAGACAAACACTTGGAATACGTCAGAAGCGCTACGAGTGCAAAAGAGATGATCGAAAACTTACGAAAAATATTCAAAAGAAAAAGTACGTTATCTGCGTTATACGTCAGGAAGAAATTATTAACCTTAAAATGTGACCCCAGTGTCGAACTGAGCGACCACTTCAACAATTTTGATATGTTAATAAGACAATTAGAAGAAACTGGAAGCACAGTAAATGAACAAGACAAGGTGTGCCACTTACTACTGACTATGCCTGACAGCTACAATACTACAATTGCCGCCTTAGAAACTACTAATGTGGAACTTACAACAGAGTATGTCAAAAGCAAATTGTTAGATGCAGAACTAAAAAACCAAAATAATTCAATGGAATCACAGGATGCACACAGCTTCCTCAGTTGCTTTAAATGTGGTAAAACTGGTCACAAAGCTATACAGTGCAGAACTGGACACTTAATGAGAGGACAGCATCGAGGCAAAATGGGCAACGTCGGATATTTCAACGGAAGTAACACTAGAGACTTCTATCGAGGCAACGGCAGAGACTTCAATCCAGGTAACGGCAGAGGCTTTAACCGAAGCAATCCCAGAGGCAACGTGAGAGGACAATCGAGGGGATCATCAAGGGACACCATACTCCAACAAGGAAAAAGTGCTATAAGTGAGAGAAATCCATTTTCTTTTGTTGCCAGTGAAAAGGTACTATCTGTTGATGTGTATAATGAGGACATTAAGTTTATTATTGATTCAGGAGCATCTCAAAATTTAGTCATTGATAGTTATGAAAAGTACATGTCAAACATTGAATATTTAGAAACTAAAACTAAGATTTATGTTGCTAATGGTCAATATTTGTTTTCAAGTAAAAAAGGGATTTTAAATGTAAAATATAATAACTTACCTATTAAAATAGAAGCACTACTTGTCAAGGGGCTATCCCACAACTTATTATCTGTTAAAAAATTGTTAGAGAAGGGAAATTCTGTCAGATTTCATAAAAATTCTGTATCAATTGCTAAAGGAAATAACATAATTTATGGTACCATGCTTAATAGTCTGTATGCAATCAATCTTACATTAAACTTAGAAAAATGTTATTCGATAAATAATGATAAAGATCTATGGCACAAAAGGTTAGGACATGCTAATAGAAAACACTTAAAATTATTGAAATTACCTATCTCAGAAAAACCATGTGGAATATGTGTAGAAGGAAAATCAACAAGATTACCATTCTCTACAACACCCAGGCCGAGATCAAAGTATATAGGAGAACTCATACACACAGATATATCAGGACCAATAAATATTCCTACACTTACAAATGAGGTATATTTTCATACAATTATAGATGATTACACACATTTCTGTGAGGTATACTTATTACAAAGAAAAAGTGAGGCAACGGATAGGCTCATAGAATATGTTAATAGAATGGAAAGACAAATAGAATGTAAAGTCAAGAAAATCAGAAGTGATAATGGTGGTGAGTTTAAAAATGAAAAACTAAATAAATTTTGCAAAGATAAGGGAATTGTTCAACAGTTTACTTTGCCTTATAGCCCACAGTCAAACGGAGTTTCAGAACGCATGAACAGAAATATTTATAACAGAGCTCGGACTTTATTAATTGAATCTGGTTTACCAAAAACCTTATGGGGTGAAGCGGTGCGATGTGCTGTCTATCAAACCAACAGATGTCCATCATCTGCTATCAACTTTCAAACCCCAGCAGAGAAAATGTTTGGAAACAAAGACTTAACAAGACTTAGGATATTTGGATCAAAATCATGGGTTCATATCATACCAAAACAAGATAAACTTTTACAAAGAGCTAAAGAAATGAGACTCGTAGGATATCGCCCAAATGGATATCGTCTATGGGACCCTACAAGTAATAAAGTGATAGTGTCAAGAGATGTCAGAATTGATGAAACTCAATTAAACTACAAGGAAACTGAAGAAAAGCATAACATAAAAGGAGAAACATACTATGAAGATGAATTAATACAAAATGAAGATACTGAGAAGGACACAGAAGCTGACCAAGAGACAAGAATACCTAATGAGAATGATGAAAACATGCAACATGATAGAATACCTGATAAAACAAATAAAGAAGTATCAAAGAATAATCAAGATGATGAAGAAGAAAATGAAAAATTGAATAAAAAAGGTAGAATAAATATACAGAAATATATAACAAGATCAGGAAGAGAAATTCGCAAACCAAGAAACTTAGAAGAATATGATCTAAATATAGCATACTGTCTTTTATCGGGAGACCCACAAGAATTTGAAGATGCAATTCATGACAAAGACTGGGAAAAAGCAATAAAGACAGAATTAAATTCACAAGTGAAATTAGAGACATGGGAAGAAGCTACATTACCAATGGGAAGTAAAGCAATAGACACAAAATGGGTATTCAGAACAAAACAAAATGGAACCAAGAGAGCTCGATTAGTAGCGAAAGGTTTTCAGCAACAGAACAATGATAATCATTATGCTCCGGTAGCCAAATTGTCAACTATCAGATTAATGATGAGTTTAGCAGTTCAACTGGATTTGTCATTAAAGCAATTGGACGTACCAACAGCCTTCTTAAATGGAAAATTAAACGACAATGTCTATATAAAATGTCCCAAAGGAATGGAAATTAGTGAAGGAAAAGTTTTAAAACTGAAAAGGGCTTTGTATGGATTAAAAGAAGCACCTAAATGCGGGAACCAAAGATTTCATAATTTTGTCACTCAGAAAGGGTTTGTACAATCACAGCATGATTTATGTTTATATGGAAAAGGAAAAATTTGGATATTACTGTATGTGGATGATATTTTATACCTTGGAAATAGCAATGAGATGATAAAGGAATTAGAAAAGGAATTTAAAGTAAAAAACTTAGGAGAAGTACATCAATATTTAGGATTGGAAGTAACAAGAACAGAAGACAGCTTGGAAATAAGACAAACAGAAATAATTAAAAGACTTCTGGAGAAATATCACATGCAAGATTGCAAATCAAGCAAGACTCCAATGGAAATTAATTTTAATGTAAACATTCCATCACCATCAGATATAATTGAAGTACCCTTCAAGGAATTAATAGGATCTTTGTTGTACATTGCTGTGAATAGTCGACCGGATATTGCTTATGCTGTATCATTCTTAAGCAGATTCTTAGATAAACCCACACAAGAATTATGGACAGCAAGTAAGAGAGTGTTACGTTATCTTAAAGGAACCTCGCATCAGGGACTGATTTATAGGAAGACCGAAGAGTACACAAAACTTATAGCCTACTCAGACGCTGACTGGGCAGCAGATAGAACAGACCGTAAGAGCACAAGTGGCTGTGCTATATATCAAGGCCAGAACTTAATAACTTGGTTCTCTAGAAAGCAAACATGTACCGCCCTGTCAACAGCTGAAGCTGATGAAATTTGCGAACTGACTAGCATTAAGAAGGAGGACGTGATCAGTACATTGCAGAATTTGAACCTCATCAACTACTACAAGGGACAGTACATTATCTCGGTCAACCAGCAACACGAGAAAGCAATGGAAAAACGTATGCTAAGAATCGATCCAAAATGTTTACACTGGACTCCAAAAGATTGGTCTAAACGGGCGAAATGTGTTTGA
Protein
MNENDDELTTFCDSTSSLVEGCRLPVRMQGGDDWPLAEIISIKEVQGQRGFYVHYVDFNKRLDEWVGESWLDTRKVQFPRRDGTATGGTTTPKKTLIGSGGGVMPTFINDTVCNENQKSSNARTITNQLTQPKTHEKAHFSNALNGSAQKNALAVVEPRQLVSRPASPTLVNDSSSLVNGGAVLAAALQKKMNRKRKPPSLDNDVSLHSEPSQEGEADATASGTATPTARPRQSGSLVAHGHDDLVTRMKNIEMIELGRHRIRPWYFAPYPQEMVNLPCIYICEFCLKYRKSKKCLERHLIKCKLKHPPGNEIYRKGSISFFEIDGRKNKCYAQNLCLLAKLFLDHKTLYYDTDPFLFYVMTEFDSRGFHIVGYFSKEKESTEDYNVACILTLPPYQRKGYGKLLIEFSYELSKFEGKTGSPEKPLSDLGLLSYRSYWAQTILDILLHIKPVGDNEKPVITINTWIFRISCILEEKECKEAIEDGITEEILKSEKFKKKDAKARSLIVNCLSDKHLEYVRSATSAKEMIENLRKIFKRKSTLSALYVRKKLLTLKCDPSVELSDHFNNFDMLIRQLEETGSTVNEQDKVCHLLLTMPDSYNTTIAALETTNVELTTEYVKSKLLDAELKNQNNSMESQDAHSFLSCFKCGKTGHKAIQCRTGHLMRGQHRGKMGNVGYFNGSNTRDFYRGNGRDFNPGNGRGFNRSNPRGNVRGQSRGSSRDTILQQGKSAISERNPFSFVASEKVLSVDVYNEDIKFIIDSGASQNLVIDSYEKYMSNIEYLETKTKIYVANGQYLFSSKKGILNVKYNNLPIKIEALLVKGLSHNLLSVKKLLEKGNSVRFHKNSVSIAKGNNIIYGTMLNSLYAINLTLNLEKCYSINNDKDLWHKRLGHANRKHLKLLKLPISEKPCGICVEGKSTRLPFSTTPRPRSKYIGELIHTDISGPINIPTLTNEVYFHTIIDDYTHFCEVYLLQRKSEATDRLIEYVNRMERQIECKVKKIRSDNGGEFKNEKLNKFCKDKGIVQQFTLPYSPQSNGVSERMNRNIYNRARTLLIESGLPKTLWGEAVRCAVYQTNRCPSSAINFQTPAEKMFGNKDLTRLRIFGSKSWVHIIPKQDKLLQRAKEMRLVGYRPNGYRLWDPTSNKVIVSRDVRIDETQLNYKETEEKHNIKGETYYEDELIQNEDTEKDTEADQETRIPNENDENMQHDRIPDKTNKEVSKNNQDDEEENEKLNKKGRINIQKYITRSGREIRKPRNLEEYDLNIAYCLLSGDPQEFEDAIHDKDWEKAIKTELNSQVKLETWEEATLPMGSKAIDTKWVFRTKQNGTKRARLVAKGFQQQNNDNHYAPVAKLSTIRLMMSLAVQLDLSLKQLDVPTAFLNGKLNDNVYIKCPKGMEISEGKVLKLKRALYGLKEAPKCGNQRFHNFVTQKGFVQSQHDLCLYGKGKIWILLYVDDILYLGNSNEMIKELEKEFKVKNLGEVHQYLGLEVTRTEDSLEIRQTEIIKRLLEKYHMQDCKSSKTPMEINFNVNIPSPSDIIEVPFKELIGSLLYIAVNSRPDIAYAVSFLSRFLDKPTQELWTASKRVLRYLKGTSHQGLIYRKTEEYTKLIAYSDADWAADRTDRKSTSGCAIYQGQNLITWFSRKQTCTALSTAEADEICELTSIKKEDVISTLQNLNLINYYKGQYIISVNQQHEKAMEKRMLRIDPKCLHWTPKDWSKRAKCV

Summary

Pfam
PF00665   rve        + More
PF07727   RVT_2
PF13976   gag_pre-integrs
PF00098   zf-CCHC
PF13961   DUF4219
Interpro
IPR036397   RNaseH_sf        + More
IPR039537   Retrotran_Ty1/copia-like       
IPR001584   Integrase_cat-core       
IPR013103   RVT_2       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR025724   GAG-pre-integrase_dom       
IPR025314   DUF4219       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D
PDB
2OU2     E-value=9.99373e-108,     Score=1003

Ontologies

Topology

Length:
1726
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00660999999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00019
outside
1  -  1726
 
 

Population Genetic Test Statistics

Pi
398.604433
Theta
197.337612
Tajima's D
3.970241
CLR
0.38772
CSRT
0.998800059997
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号