SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10480
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.093 Nuclear   Reliability : 1.473
 

Sequence

CDS
ATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGTATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGCTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCTCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAAGTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTTATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATCGTCAACGATGTTCCCCGGTCGCCGCCGACCCATTTAG
Protein
MVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPLNPDSIPSPQDTSEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVSMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLSSTMFPGRRRPI

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB055391    BAB21761.1    AB018558    BAA76304.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    KQ971729    KYB24751.1    GBBI01004395    JAC14317.1    GGMS01006359    MBY75562.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GGMR01018716    MBY31335.1    GGMR01015412    MBY28031.1    ABLF02008153    ABLF02008462    ABLF02008464    GALX01005359    JAB63107.1    GGMR01004661    MBY17280.1    GFTR01008262    JAW08164.1    ABLF02042518    ABLF02057746    GFTR01008279    JAW08147.1    ABLF02034467    GEDC01029594    JAS07704.1    ABLF02042385    ABLF02040174    ABLF02040183    ABLF02055266    ABLF02041767    KK119261    KFM75202.1    GGMR01012443    MBY25062.1    GGMR01002322    MBY14941.1    NEVH01005277    PNF39135.1    ABLF02028535    ABLF02028545    GFTR01008038    JAW08388.1    GGMR01000226    MBY12845.1    ABLF02023911    NEVH01011985    PNF31054.1    GGMR01006581    MBY19200.1    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    NEVH01021205    PNF19912.1    GGMR01013409    MBY26028.1    ABLF02024246    NEVH01006736    PNF36716.1    KK118005    KFM71947.1    GGMS01002786    MBY71989.1    GFTR01008256    JAW08170.1    GFTR01008271    JAW08155.1    GFTR01008261    JAW08165.1    GFTR01008251    JAW08175.1    GFTR01007929    JAW08497.1    GEZM01053022    JAV74219.1    KK113281    KFM59799.1    NNAY01003095    OXU19992.1    GGMR01016905    MBY29524.1    GGMS01017365    MBY86568.1    GGFL01004957    MBW69135.1    GGMR01012676    MBY25295.1    GFXV01000908    MBW12713.1    GGFL01005012    MBW69190.1    GFTR01008246    JAW08180.1    KK115285    KFM64681.1    GFTR01008260    JAW08166.1    NEVH01002556    PNF42024.1    GGMS01002992    MBY72195.1    GBBI01004571    JAC14141.1    GGMS01006655    MBY75858.1    AY060438    AAL25477.1    GFXV01002840    MBW14645.1    GGMR01012305    MBY24924.1    GFTR01008257    JAW08169.1    GGMR01016297    MBY28916.1    NEVH01016302    PNF25823.1    RSAL01000708    RVE41206.1    GGMS01002955    MBY72158.1    GGMR01000676    MBY13295.1    GFTR01008151    JAW08275.1    GEZM01021881    JAV88842.1    KF280391    AIE77315.1    GGMR01003407    MBY16026.1    ABLF02041861    ABLF02016634    GDHC01018248    JAQ00381.1    GGMR01011511    MBY24130.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
PF10551   MULE
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR013083   Znf_RING/FYVE/PHD       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
617
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
8.26204
Exp number, first 60 AAs:
0.0546
Total prob of N-in:
0.03708
outside
1  -  617
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号