SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10357
Pre Gene Modal
BGIBMGA007250
Annotation
PREDICTED:_uncharacterized_protein_LOC101737350_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.244
 

Sequence

CDS
ATGGGGTGTGTAAGTAACGGTGATGGTTCGTTTAATAAATACGAATTTACATGTGGCGAAGGAACAGTTTGGGATAGTAAAATTGAAGCATGTAATCATGCATGGGCAGTGGAAAGTTGCGGTGGTATTAGTGTATCAAGTTCTAGTGAAATTTTTGATTTAGTTTCCACAATTTCTCCTCAATTGACGACTACAAACAAAGCCGAAAATTCCAACATTGAATCTACAGGCGACACGGCGACGACGACACTAGTATTAGTATCATTTTCTACTACAACTACAGAAACCGTTGCTTTGACAACAAATACATGTAAAAGCACTGGCTTCATAGGGGATCAAAAAGATTGTAAGAAATTCTATAGATGTGTTGACAATGGAGATGGAACTTTTACACGTTTTGAATTTAATTGTGGGGAAGGAACTGTTTGGGATAGTAAAATTGGTAATTGTAATCATGCTTGGGCTGTAGAAAAATGTGGAGAGTATGGCGAAGATGAAAATTCTAACGCAGCCAATACTTCTGATGGTAAACCAATTTTCGCAGATGAATATGACAACGGAGTTGCAACAACAAGTAAAACGACTAATAATGAAAAACCAGATTTTATTCAAACAACAGTATTAAGTCCAATTGTAAACACAATTTGTAAGCAGAGTGGATTTATTGTTGACAAAAATGACTGTCAGAAATTTTATAGGTGTGTTGATGATGGAAAGGGTGGATTTATACAGTTCGATTACCGATGTGGGGAGGGTATCGTTTGGGATTCTAGTATTGAAGCTTGTAATCATGTATGGGCTGCGCAAGAGTGCAGATTTGATAATGTTACAAGTGAAACGATTGATAGTTCAACACATGAGTCGCCACCTACCTCTTCCGTTCAAGAATCACTAAATTCCACATTACCTTCAGTAATTAATACCGTCGCAACATCTACAGAAAAGGCCGTAAGCGATTACTGCACGCAAGATGGTTTTATCGGTGACAAAAGAGATTGTAAAACGTTTTATCGTTGCGTTCACAATAGTCATGGTGATTTCATAAAATATGAATTTCGCTGTGGAGAAGGGACTTTTTGGAACCAAGAAATACAAGCTTGTGACCATGTTTCAGAAAATAAGAGATGCTACAGTCCTGATCATGAAATCGTTGATACTAGAACTCAAATCGAAAATGATGAAATTTATACAGAAGCGATGACCGAAATCATAAGTACATCGCATTCACCAATTGTGACGCAAAAACCTGTGATCTCTGAGGATACTTGTCAAAATGAAGGATTTTTTGGGGATTCTAGTGATTGTCAAAAATTTTATAGGTGTGTGGAAGATTCAAAAAATGGATACACAAAATATGAATTCGTTTGTGGCGCTGGTACAATTTGGAATCAAGATATTATAGCTTGTGACCATCCAACTTCAGAGAATAAATGCTTAGGTGAAAATATCAATTCTAATCCTAACCAAACGAATGAATCAAATGTAGATGGAGAATCTTCAGATATTACAAGCACGCTTAAGCCGCATTCTACTCGAGAACCAGAAAATTCAACGTCTGCAGACACTGACGAATGCATTTCTGAAGGATTTTATGCAAACTCGCATGATTGTAAGAAATTTTTCCGTTGCGTCATAAACGACAAAGGAACGTTTACCAAATATGATTTTATTTGTGGTATTGGTACAATATGGGTTCAAGAGATACAAGCATGTGATCATAATAATGGAATCGAGACTTGCACTTCGATAAATATACCAGAAACTTCTACAGTTACATACGCTTCAACTACAAGCCAATCGAGCTCAAATACCACTCCATTACTGTCAACACCCATAAAAAATGATAATGACTACTACACCAGTACTAAGAAACCCAATACAGAAGTATGTGAAGCAGAGGGATTCTTCGGAAATGATAATGATTGCAAGAAATTCTATCGCTGTGTAGATAATGGTCAAGGTGGCTATACAAAACACGAGTTCAGTTGTGGTGAAGGGACCGCGTGGGATACCACTATTGAAAGTTGCAATCACATAGACAACGTTAAAAATTGTCATTTTTCACACCAAGATGAAAGTCAAACACAGCCGATATTATTCGACGAAATGCCATCCACTGAAAATGAACAGGGCACAACAAGAGTTCCATCTTCTTCACAATCTACTGAGAGCAGTATTTCGGATGATAAAGCTAACTGTGAAAGTGAAGGCTACTTTGGCGACACTAAGGATTGTAAAATATTTTATAGATGTGTAGATAATGGAAAAAACCGATTTACCAAATATGAATTTACTTATGGAGAAGGTACAATCTGGGATCAAGACTTAACTACATGTAATCATCCACAAGACGTATTAAAACCTTCCTGTGGTCACACTAGTGAACAGATTTCTACATCATCTACAATGAGTTCTTCGTCATCAGACTCTCCTTCAGCAACCAGTACTTTATCAACAACCGCAAGTACGACAGAAATCAGTAATAGTACCTCAACCAACTCTTCCCAACAAAGTTCGAATAAACCAAACCAGAATATCACTTGTCCTAAAGAAGGTTTTTATCCGAATCCTAACGATTGCAAGAAATTTTATAGATGTGTTGATTGGGATAGTAATGGTCAAAGATTTTCAGTGTATCATTTTGAATGTGCAGATGGAACTATTTGGGATCCTGCAGTTAATACTTGTAATCATGAAGAATCAGTTTATCCTCCTAGAGACTGCAGTAATACACAATCAGAAATCCAAATCACAGGACAAGAAACTACTACAGAAGAACAACTGCAAGAATCATCTACACAGACAACTAATGAAATGACAACTGCAACTAATGAAGAGGCGGCTACTCAACAAACATCAACGACTCAAAAAACTACAACAACGGAAGAAACTACTATGAGTGAAGAGCCTACAACACGACAAACAACCCCACTAGATACAAGTACTGAATCGACACATACTACAATGCAAAGTACAACTCAGCAACACTCTACTGAAGAAATTTCAACATCACAAACGCATGCACAAAGTACTACGCAACAAACAACAACTCAAACACAAACAAGCACACAAATTACTGTGCAACAAACAACAACATCTGAACCCAGTACAACTCAACAACAAACAAGTTCACAAACCACTACAGATCAAACAATGGAAAATTCTACTAGTGATCAAACAACATCAAGCACTAATACGGCCACAACACAACCAACAACAAGTGAATATTCCAGTACTGAGATATCAACTACTTCAGAGACGGCTATAACAGAGCAATCTACAAATCAAGCAACCAATTCAACTCAAATGACAACTACTCTCACTGATGTCTCAACTACTACAGATCCAACCCTATCTACTACAACAGAAACAGCCAGTATAACAGAAGTCAGTCAAGAATTAACAACTACTGAAGAAAATTCATCTACGACCAGTGAAGGACCCACAGAAGTTTCTACTCAAGAAATTGGCACTGAATCTTCTACCACCAATATGGAAACTTCCACTGAAGGAAATACTGATGGCAACTGCCCTAATACGGAAGATGATCAGCATTTGTTTGTATGTCCTACGTCGTTCAGAAGACATCCAAAGTATTGTAATATATTCTATCAATGTACAGAAGATGATGAAACACACGAAATTAAAATAGCTACTTTCAACTGTCCGAATAATACTATATATGATGAAAGTCAAACTAAATGTGTTGAACAAGATAAAACGAATATTGAGTGCGATGGTGAAATATCATCAAGGCGAAGACTGAAACATTTATCATTAAATTACAAAGATCCTGTATCGTGGATGGTGGATCACGATCCAGGCCTTAAACAGGAGGAAAACTATCCTCTTTTAAAGGTGGATGCGGGAGGAGGTGATTCTTGTGTGGGTCCTCAAGCGCCGCTTACTACGGTATCTCCAGGATGGACCATTGCTTCTGGGAGAAAACACTCTTGGCTTAATCGGTGGCCCGGCCCCGGTCCGAGAAGTTGGGGCCTCGCCGCAAGGCGAGTGTTTTCAAGACCCGGGGCCGCCCCACCTGGGTACTCAGCGATCATGGACGCTGTATTCGCGGAATTCCTCCGACTTCGCCACCCACAGCTCGCCTCGGAGTTCTTGGCCTTCAAGGCCAATCACACTGCGAGCCCTCTCGAGGACTCCGCCGCGCTCGCTGCTCCTGCGTCGCCTGTACCTGCGTGCAGAGCTTCTGCATTGAGCACCGCAGCCACTGTCGTGCCTGCCGCTCCCGTGTCGCCTATACTGGCGAGAAAAGCTGCTGCGTCGTCCGCCGTGACCATCGTTTCAGCTGAGCGATCATCCGCGGCCTCCGTCGCGCCCTCTAAAACACCTACACTTGCTCGTAGGTCGCCTGCACCCGCCTCCTCGTGCTCCGACTCTGACTCGGACATGGAGGTCGACCTCGCCCCCGCCTCATCGACGGATGGATTCACCCTGGTACAGAAGGGTAAGAAGCGTGCCGCGGAGTCTCGAGCTCCCGCGGCCGCTAAAATTAGCAAAGCCGTGAACGCGTCGCGCCCCCGCCCTCAGACTCCCGTTGCGCCCCCAGCCCGTGCCACTCCGTCGCCGCGTCCGGTGGCACAAAATAAAACCCAGACCCCTCCCCCGGTTATCCTTCAGGAGAAGGCAGCTTGGGATCGAGTTTGCCTGGCCCTTAAGGCCAAAAATATAAATTTCACGAATGCCCGTAACCTCGCGAACGGCATTCAAATTAAGGTTCAAACACCCGACGACCATAGGGCCCTCTCTTCTTACCTCCGTAAGGAGCGTATAAGTTTCCATACGTATACGCTCCAGGAGGAGCGCGAACTCCGCGTTGTAATACGCGGAATCCCTAAAGAGTTAGATGTAGAGCTCGTAAAAGCCGACCTGTTAGAACAAGGCCTACCAGTGAATTCTGTGCACCGTATGCACACCGGTCGCGGTAGGGAGCCATATAATATGGTTCTAGTCGCTCTCCAACCTACCCCCGAGGGTAAGAAAATCTTTAACACACAGACCGTCTGTAGGCTCTCTGGTATCGCTGTCGAAGCCCCCCATAAAAAAGGCACTCCTAGCCAGTGCCATAACTGTCAATTGTACGGGCACTCTTCCCGTAACTGTCACGCGCGCCCCCGATGTGTTAAGTGTTTGGGCGATCACGCCACGGCCCTCTGCGCTCGCGACCAAAAAACCGCGACGGAACCGCCTAGCTGCGTCCTGTGTCGAACACAGGGTCACCCCGCGAATTACCGTGGTTGCCCCCGAGCCCCTAAAATAAATCGCCGCGTCGCCCGCCAAAACCGCCTCCGAGCTTCCGGCCCAGACATCAAAGCCTCGGCACCCTCTGCGTCGCAGGCTAAGCCAGCGTTCGTTCCGGCGGCGGTGCCCAGTGTCTCGGCCTGGGCAAAACCGCTGCCGTACACGAACACGGCTACAACTCCCTCCTCCGCGATTCGTCCCGCCCCCGCGACTCGTCCCTCTCCCGCGACTTGCCCTCCGACCGCGTCCGACAATCTCGCTTTAGCGATCGACTTCTTTCAGTCGATCAACTTTGAGCGCGTTAACGCTTTGGGCGACGCCATTCGCGCTGCCTCCACTGCACAACACTTTATCGCCGTTGTGCAGGAATACGCCGACGAGACCCTACTTAAGCCCGCGCGCCGTGACCCTAAAATCGCGAACTATAACATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGTTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGTATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTTATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGGAGAACAGCCGATGGCGTCGACGGAGAATATTTACAATTTCATGATCATTCACGATTTGAAGATCATAGCGACCTCAATGGGCTTCATACAATATGTTTGTCTGCTTATAGGATGTTTAACAATAAACGCGGTCGGCGAGAATTCGCATGCCGCTCAAATCAAGATGCGTGCTCTTCTGGTAGCCCTGCTGGGAGTTTCTATGTCGGCCTGCGCTTTTGCCTCGCAGCCAGTCGAGTTAGAGTTGGACGACGATGACGTCACGCAAAAATTGAGTAACCAATCGTGGTGGCGTCGCGGTGCTCGATGGCTTGCAGCACCGGCTCTATTGGTAGTCGCTTTAGAAGCTGCTTCAGATGCGAGCGACGCGCTATTGGCTGCGGTGCTGCGGGGTTCGGCTGAACCAGCCAAAATTGCCCTACAGACTATCGGTGCAGGATTACTTGTCACGGTCGAAATACTGGTTTGGTACTTTATAGCTAAATTTTTTGAATACAGTCCACCGCCCTTAGTCGAAGACAAAGACAGAGAAACTGTAAAGGCATCGCCAGAATCACAATGA
Protein
MGCVSNGDGSFNKYEFTCGEGTVWDSKIEACNHAWAVESCGGISVSSSSEIFDLVSTISPQLTTTNKAENSNIESTGDTATTTLVLVSFSTTTTETVALTTNTCKSTGFIGDQKDCKKFYRCVDNGDGTFTRFEFNCGEGTVWDSKIGNCNHAWAVEKCGEYGEDENSNAANTSDGKPIFADEYDNGVATTSKTTNNEKPDFIQTTVLSPIVNTICKQSGFIVDKNDCQKFYRCVDDGKGGFIQFDYRCGEGIVWDSSIEACNHVWAAQECRFDNVTSETIDSSTHESPPTSSVQESLNSTLPSVINTVATSTEKAVSDYCTQDGFIGDKRDCKTFYRCVHNSHGDFIKYEFRCGEGTFWNQEIQACDHVSENKRCYSPDHEIVDTRTQIENDEIYTEAMTEIISTSHSPIVTQKPVISEDTCQNEGFFGDSSDCQKFYRCVEDSKNGYTKYEFVCGAGTIWNQDIIACDHPTSENKCLGENINSNPNQTNESNVDGESSDITSTLKPHSTREPENSTSADTDECISEGFYANSHDCKKFFRCVINDKGTFTKYDFICGIGTIWVQEIQACDHNNGIETCTSINIPETSTVTYASTTSQSSSNTTPLLSTPIKNDNDYYTSTKKPNTEVCEAEGFFGNDNDCKKFYRCVDNGQGGYTKHEFSCGEGTAWDTTIESCNHIDNVKNCHFSHQDESQTQPILFDEMPSTENEQGTTRVPSSSQSTESSISDDKANCESEGYFGDTKDCKIFYRCVDNGKNRFTKYEFTYGEGTIWDQDLTTCNHPQDVLKPSCGHTSEQISTSSTMSSSSSDSPSATSTLSTTASTTEISNSTSTNSSQQSSNKPNQNITCPKEGFYPNPNDCKKFYRCVDWDSNGQRFSVYHFECADGTIWDPAVNTCNHEESVYPPRDCSNTQSEIQITGQETTTEEQLQESSTQTTNEMTTATNEEAATQQTSTTQKTTTTEETTMSEEPTTRQTTPLDTSTESTHTTMQSTTQQHSTEEISTSQTHAQSTTQQTTTQTQTSTQITVQQTTTSEPSTTQQQTSSQTTTDQTMENSTSDQTTSSTNTATTQPTTSEYSSTEISTTSETAITEQSTNQATNSTQMTTTLTDVSTTTDPTLSTTTETASITEVSQELTTTEENSSTTSEGPTEVSTQEIGTESSTTNMETSTEGNTDGNCPNTEDDQHLFVCPTSFRRHPKYCNIFYQCTEDDETHEIKIATFNCPNNTIYDESQTKCVEQDKTNIECDGEISSRRRLKHLSLNYKDPVSWMVDHDPGLKQEENYPLLKVDAGGGDSCVGPQAPLTTVSPGWTIASGRKHSWLNRWPGPGPRSWGLAARRVFSRPGAAPPGYSAIMDAVFAEFLRLRHPQLASEFLAFKANHTASPLEDSAALAAPASPVPACRASALSTAATVVPAAPVSPILARKAAASSAVTIVSAERSSAASVAPSKTPTLARRSPAPASSCSDSDSDMEVDLAPASSTDGFTLVQKGKKRAAESRAPAAAKISKAVNASRPRPQTPVAPPARATPSPRPVAQNKTQTPPPVILQEKAAWDRVCLALKAKNINFTNARNLANGIQIKVQTPDDHRALSSYLRKERISFHTYTLQEERELRVVIRGIPKELDVELVKADLLEQGLPVNSVHRMHTGRGREPYNMVLVALQPTPEGKKIFNTQTVCRLSGIAVEAPHKKGTPSQCHNCQLYGHSSRNCHARPRCVKCLGDHATALCARDQKTATEPPSCVLCRTQGHPANYRGCPRAPKINRRVARQNRLRASGPDIKASAPSASQAKPAFVPAAVPSVSAWAKPLPYTNTATTPSSAIRPAPATRPSPATCPPTASDNLALAIDFFQSINFERVNALGDAIRAASTAQHFIAVVQEYADETLLKPARRDPKIANYNMVRNDRLSARGGGTVIYYRRALHCVPLDPPALVNIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSIPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPGEQPMASTENIYNFMIIHDLKIIATSMGFIQYVCLLIGCLTINAVGENSHAAQIKMRALLVALLGVSMSACAFASQPVELELDDDDVTQKLSNQSWWRRGARWLAAPALLVVALEAASDASDALLAAVLRGSAEPAKIALQTIGAGLLVTVEILVWYFIAKFFEYSPPPLVEDKDRETVKASPESQ

Summary

Uniprot
ProteinModelPortal
PDB
6G9E     E-value=0.00190498,     Score=106

Ontologies

Topology

Length:
2966
Number of predicted TMHs:
3
Exp number of AAs in TMHs:
76.90969
Exp number, first 60 AAs:
0.00017
Total prob of N-in:
0.00011
outside
1  -  2802
TMhelix
2803  -  2825
inside
2826  -  2837
TMhelix
2838  -  2860
outside
2861  -  2917
TMhelix
2918  -  2940
inside
2941  -  2966
 
 

Population Genetic Test Statistics

Pi
3.130727
Theta
22.267495
Tajima's D
0
CLR
0.590894
CSRT
0.374831258437078
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号