SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10355
Pre Gene Modal
BGIBMGA007250
Annotation
PREDICTED:_uncharacterized_protein_LOC101737350_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.432
 

Sequence

CDS
ATGTCTACTACTGAAGTTGACGTAGTGGAATCAGCACTTAACGCGTCTAACTCTTTCACACCGTCAGCACCTGTCATCCAAACAACTATAGAAATTGACGCTGAAGAAGAAGACATCGGGTATGGAAATATTCATTCTTCAGTAAAAACGACGACTCCCAGAACGACCACTATCGATAGTAGCCCTCAAATTTCACCATTGAACGATTGTAAGTCAAGTGGCTTCAAAGGTGACTCAAAAGATTGTAGTATATTTTATAGGTGTGTCGAAGATGCTAATGGAAGATATACAAAATATGAATTTAAATGTGGGGAAGGTACAGTCTGGGATTCTAATCTAGAAGCTTGTAATCATGCTTGGGCAGTAAAAAAATGTGGAGAGAATGAATTATCTATTGAAAACATATCAACAACCACTGAAACTACAACTATTAGCAAAAATCCAACATCACCTAGTCAAACTATAATGAATAGTAAAAATCCAATAACGACATTAAATGGTAATCTAACTACCACTACTACTACTGAAATATATCAACCTGATCAAGAAGACTCTGGTTATATTGGTCATATTGAAGAAATCACATCCTCAACAACAAAACTACCCGATTCTTCGATAAACGGAAGTAGTGAATGTAAATCAAATGGCTTTCTTGGAGATAAAAATAACTGTAAAATTTTTTACAGGTGTGTAAGTAACGGTGATGGTTCGTTTAATAAATACGAATTTACATGTGGCGAAGGAACAGTTTGGGATAGTAAAATTGAAGCATGTAATCATGCATGGGCAGTGGAAAGTTGCGGTGGTATTAGTGTATCAAGTTCTAGTGAAATTTTTGATTTAGTTTCCACAATTTCTCCTCAATTGACGACTACAAACAAAGCCGAAAATTCCAACATTGAATCTACAGGCGACACGGCGACGACGACACTAGTATTAGTATCATTTTCTACTACAACTACAGAAACCGTTGCTTTGACAACAAATACATGTAAAAGCACTGGCTTCATAGGGGATCAAAAAGATTGTAAGAAATTCTATAGATGTGTTGACAATGGAGATGGAACTTTTACACGTTTTGAATTTAATTGTGGGGAAGGAACTGTTTGGGATAGTAAAATTGGTAATTGTAATCATGCTTGGGCTGTAGAAAAATGTGGAGAGTATGGCGAAGATGAAAATTCTAACGCAGCCAATACTTCTGATGGTAAACCAATTTTCGCAGATGAATATGACAACGGAGTTGCAACAACAAGTAAAACGACTAATAATGAAAAACCAGATTTTATTCAAACAACAGTATTAAGTCCAATTGTAAACACAATTTGTAAGCAGAGTGGATTTATTGTTGACAAAAATGACTGTCAGAAATTTTATAGGTGTGTTGATGATGGAAAGGGTGGATTTATACAGTTCGATTACCGATGTGGGGAGGGTACCGTTTGGGATTCTAGTATTGAAGCTTGTAATCATGTATGGGCTGCGCAAGAGTGCAGATTTGATAATGTTACAAGTGAAACGATTGATAGTTCAACACATGAGTCGCCACCTACCTCTTCCGTTCAAGAATCACTAAATTCCACATTACCTTCAGTAATTAATACCGTCGCAACATCTACAGAAAAGGCCGTAAGCGATTACTGCACGCAAGATGGTTTTATCGGTGACAAAAGAGATTGTAAAACGTTTTATCGTTGCGTTCACAATAGTCATGGTGATTTCATAAAATATGAATTTCGCTGTGGAGAAGGGACTTTTTGGAACCAAGAAATACAAGCTTGTGACCATGTTTCAGAAAATAAGAGATGCTACAGTCCTGATCATGAAATCGTTGATACTAGACCTCAAATCGAAAATGATGAAATTTATACAGAAGCGATGACCGAAATCATAAGTACATCGCATTCACCAATTGTGACGCAAAAACCTGTGATCTCTGAGGATACTTGTCAAAATGAAGGATTTTTTGGGGATTCTAGTGATTGTCAAAAATTTTATAGGTGTGTGGAAGATTCAAAAAATGGATACACAAAATATGAATTCGTTTGTGGCGCTGGTACAATTTGGAATCAAGATATTATAGCTTGTGACCATCCAACTTCAGAGAATAAATGCTTAGGTGAAAATATCAATTCTAATCCTAACCAAACGAATGAATCAAATGTAGATGGAGAATCTTCAGATATTACAAGCACGCTTAAGCCGCATTCTACTCGAGAACCAGAAAATTCAACGTCTGCAGACACTGACGAATGCATTTCTGAAGGATTTTATGCAAACTCGCATGATTGTAAGAAATTTTTCCGTTGCGTCATAAACGACAAAGGAACGTTTACCAAATATGATTTTATTTGTGGTATTGGTACAATATGGGTTCAAGAGATACAAGCATGTGATCATAATAATGGAATCGAGACTTGCACTTCGATAAATATACCAGAAACTTCTACAGTTACATACGCTTCAACTACAAGCCAATCGAGCTCAAATACCACTCCATTACTGTCAACACCCATAAAAAATGATAATGACTACTACACCAGTACTAAGAAACCCAATACAGAAGTATGTGAAGCAGAGGGATTCTTCGGAAATGATAATGATTGCAAGAAATTCTATCGCTGTGTAGATAATGGTCAAGGTGGCTATACAAAACACGAGTTCAGTTGTGGTGAAGGGACCGCGTGGGATACCACTATTGAAAGTTGCAATCACATAGACAACGTTAAAAATTGTCATTTTTCACACCAAGATGAAAGTCAAACACAGCCGATATTATTCGACGAAATGCCATCCACTGAAAATGAACAGGGCACAACAAGAGTTCCATCTTCTTCACAATCTACTGAGAGCAGTATTTCGGATGATAAAGCAAACTGTGAAAGTGAAGGCTACTTTGGCGACACTGAGGATTGTAAAATATTTTATAGATGTGTAGATAATGGAAAAAACGGATTTACCAAATATGAATTTACTTGTGGAGAAGGTACAATCTGGGATCAAGACTTAACTACATGTAATCATCCGCAAGACGTATTAAAACCTTCCTGTGGTCACACTAGTGAACAGATTTCTACATCATCTACAATGAGTTCTTCATCATCAGACTCTCCTTCAGCAACCAGTACTTTATCAACGACCGCAAGTACCACAGAAATCAGTAATAGTACCTCAAACAACGCTTCCCAAGAAAGTTCGAATAAACCAAACCAGAATATCACTTGTCCTAAAGAAGGCTTTTATCCGAATCCTAACGATTGCAAGAAATTTTATAGATGTGTTGATTGGGATAGTAATGGTCAAAGATTTTCAGTGTATCATTTTGAATGTGCAGATGGAACTATTTGGGATCCTGCACTTAATACTTGTAATCATGAAGAATCGGTTTATCCTCCTAGAGACTGCAGTAATACACAATCAGAAAGCCAAATCACAGGACAAGAAACTACTACAGAAGAACAACTGCAAGAATCATCTACACAGACAACTAGTGAAATGACAACTGCAACTAATGAAGAGGCGGCTACTCAACAAACATCAACGACTCAAAAAACCACAACAACGGAAGAAACTACTATGAGTGAAGAGCCTACAACACGACAAACAACCACACTAGATACAAGTACAATACATAGTACAACTCAGCAACACTCTACTGAAGAAATTTCAACATCACAAACGCATGCACAAAGCACTACGCAACAAGCAACAACTCAAACACAAACAAGCACACAAATTACTGTGCAACAAACAACAACATCTGAACCCAGTACAACTCAGCAACAAACAAGTTCACAAACCACTACAGATCAAACAATGGAAAATTCTACTAGTGATCAAACAACATCAACCACTAATACGGCCACAACACAACCAACAACAAGTGAATATTCCAGTACTGAGATATCAACTACTTCAGAGACGGCTATAACAGAGCAATCTACAAATCAAGCAACCAATTCAACTCAAATGACAACTACTCTCACTGATGTCTCAACTACTACAGATCCAACCCTATCTACTACAACAGAAACAGCCAGTATAACAGAAGTCAGTCAAGAATTAACAACTACTGAAGAAAATTCATCTACGACCAGTGAAGGACCCACAGAAGCTTCTACTCAAGAAATTGGCACTGAATCTTCTACCACCAATATGGAAACTTCCACTGAAGGAAATACTGATGGCAACTGCCCTAATACGGAAGATGATCAGCATTTGTTTGTATGTCCTACGTCGTTCAGAAGACATCCAAAGTATTGTAATATATTCTATCAATGTACAGAAGATGATGAAACACACGAAATTAAAATAGCTACTTTCAACTGTCCGAATAATACTATATATGATGAAAGTCAAACTAAATGTGTTGAACAAGATAAAACGAATATTGAGTGCGATGGTGAAATATCATCAAGGCGAAGACTGAAACATTTATCATTACATTACAAAGATCCTATAATAGTTACGAGGGATAGTCAATCATGTTCATCCGAAGGCCACATGCCCTTTGAAAAGAACAGGTTTGACGATATTTCATGTTCTCGTGTCACTGAGGTCAACTGCGGGTTAGGCTTACGATGA
Protein
MSTTEVDVVESALNASNSFTPSAPVIQTTIEIDAEEEDIGYGNIHSSVKTTTPRTTTIDSSPQISPLNDCKSSGFKGDSKDCSIFYRCVEDANGRYTKYEFKCGEGTVWDSNLEACNHAWAVKKCGENELSIENISTTTETTTISKNPTSPSQTIMNSKNPITTLNGNLTTTTTTEIYQPDQEDSGYIGHIEEITSSTTKLPDSSINGSSECKSNGFLGDKNNCKIFYRCVSNGDGSFNKYEFTCGEGTVWDSKIEACNHAWAVESCGGISVSSSSEIFDLVSTISPQLTTTNKAENSNIESTGDTATTTLVLVSFSTTTTETVALTTNTCKSTGFIGDQKDCKKFYRCVDNGDGTFTRFEFNCGEGTVWDSKIGNCNHAWAVEKCGEYGEDENSNAANTSDGKPIFADEYDNGVATTSKTTNNEKPDFIQTTVLSPIVNTICKQSGFIVDKNDCQKFYRCVDDGKGGFIQFDYRCGEGTVWDSSIEACNHVWAAQECRFDNVTSETIDSSTHESPPTSSVQESLNSTLPSVINTVATSTEKAVSDYCTQDGFIGDKRDCKTFYRCVHNSHGDFIKYEFRCGEGTFWNQEIQACDHVSENKRCYSPDHEIVDTRPQIENDEIYTEAMTEIISTSHSPIVTQKPVISEDTCQNEGFFGDSSDCQKFYRCVEDSKNGYTKYEFVCGAGTIWNQDIIACDHPTSENKCLGENINSNPNQTNESNVDGESSDITSTLKPHSTREPENSTSADTDECISEGFYANSHDCKKFFRCVINDKGTFTKYDFICGIGTIWVQEIQACDHNNGIETCTSINIPETSTVTYASTTSQSSSNTTPLLSTPIKNDNDYYTSTKKPNTEVCEAEGFFGNDNDCKKFYRCVDNGQGGYTKHEFSCGEGTAWDTTIESCNHIDNVKNCHFSHQDESQTQPILFDEMPSTENEQGTTRVPSSSQSTESSISDDKANCESEGYFGDTEDCKIFYRCVDNGKNGFTKYEFTCGEGTIWDQDLTTCNHPQDVLKPSCGHTSEQISTSSTMSSSSSDSPSATSTLSTTASTTEISNSTSNNASQESSNKPNQNITCPKEGFYPNPNDCKKFYRCVDWDSNGQRFSVYHFECADGTIWDPALNTCNHEESVYPPRDCSNTQSESQITGQETTTEEQLQESSTQTTSEMTTATNEEAATQQTSTTQKTTTTEETTMSEEPTTRQTTTLDTSTIHSTTQQHSTEEISTSQTHAQSTTQQATTQTQTSTQITVQQTTTSEPSTTQQQTSSQTTTDQTMENSTSDQTTSTTNTATTQPTTSEYSSTEISTTSETAITEQSTNQATNSTQMTTTLTDVSTTTDPTLSTTTETASITEVSQELTTTEENSSTTSEGPTEASTQEIGTESSTTNMETSTEGNTDGNCPNTEDDQHLFVCPTSFRRHPKYCNIFYQCTEDDETHEIKIATFNCPNNTIYDESQTKCVEQDKTNIECDGEISSRRRLKHLSLHYKDPIIVTRDSQSCSSEGHMPFEKNRFDDISCSRVTEVNCGLGLR

Summary

Pfam
PF01607   CBM_14
Interpro
IPR002557   Chitin-bd_dom        + More
IPR036508   Chitin-bd_dom_sf       
SUPFAM
SSF57625   SSF57625       
PDB
6G9E     E-value=0.00388566,     Score=101

Ontologies

Topology

Length:
1527
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.000970000000000001
Exp number, first 60 AAs:
0.00077
Total prob of N-in:
0.00006
outside
1  -  1527
 
 

Population Genetic Test Statistics

Pi
127.269313
Theta
3.774884
Tajima's D
-1.224535
CLR
652.791949
CSRT
0.0943952802359882
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号