SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10172
Pre Gene Modal
BGIBMGA005626
Annotation
PREDICTED:_transcriptional_regulator_CRZ2_isoform_X1_[Bombyx_mori]
Transcription factor
Location in the cell
Nuclear   Reliability : 4.745
 

Sequence

CDS
ATGACTTTTGGCAAGGATTACGCCTTAAATTTTATGACCTGCCTTAACAATAATGGCCAATATTTATTTCAGACGATGACAGAAAATAGGAAAAGATCTCGGGAAGATGACACGTGCGAGTTTATGCCGCTATCAAAACGAATTAATAATTTGCACATCAACAACGGTCTTGTCAACACAAGTGCATCTCAATCACGAGATTCTAGTCAAGTAAATAGTATTATAATTGACAATGGCATATCATCGCCTAAAAGTAAACAATCCAGTGACGAAGATAGCGAGATGAATTTCGCTACGTTTGCTGCGGGAGGTGCGCATTTCGTGACCACTGGAGGGCAGCTACCGGTTACGAAAATTCAACAGAATGTGTCGAACAATGGAAACTCTTTATCACAGATGGTAGGTATGGTGGGGGGTGTCACTATGGGCGAGGGTGGCATGCAGTATGTCCGGTCGCTGGACGGCGGCACCAGTTTGCAGCCCACTCCTCAACTCATCTCCGTGCCTATAGCGTTGCCCGGAGTCAAACCTGGTGATCCGCAACCAACGGTGCAAATACAGGTGCTCAATCCGAATCTACTACAAACTCAGCAACAACCGAAATATCATATGCAAATACCCATACAGGGATTACAGAATGGTGCTGTTTTGACCTTGGCGTATTCACCGGAAACTAACGACGCTGGCACCTTACAGCTAGTCGGACAGAATTCATTAGGAGAAGGGCTCCAAGTATTAACCGCTCTCTCACCAGATCTGCAAGTTATACAGCCTTCACAAACTCGAACACATGACAGTGAACATAACCAGCCTACTATGCATCAGGTATTCATAACACCGAACCAACAGATTATTATAAATGGTCCGGATAAAGCTTTGAACAACAACACAGACAACAATAATCCGAACATCACTAATATTACCATCAAAGAGGAATGTGAAGAAAACATTGATGATGAAAGTTCACAAGGGACTGAGACAAGTGACAGTATGTCATATCCATCGAACCCCAGTGATGAGGCGCTGCTAATAAAGTACCTCAACCAATTTCCGCAGGAAAAACAATCATTGCCTGCTTCTCTACAACAGTTCTTAAGGCTGAAACATACTGAGGCAAAAAAGCAGATGATCGAAGTTGAAGTTCCACCAGAGCACGACAAAACAGTCGAGGCCGTCGCTGAAGCCATTCTCAGTGAAGACGGCACTTTAAGAATAAAAAGCAAGAAAAGAAAGAAATACAAAAAGAAGCCAAGTAAACCGGCCCGACCGAAGCCAGGGCAGGTTGTCATAGCGACTGCCGCCGATGGAACACCCATATATTGCTGTCCAGAATGTCAGATGGCATACCGAGAAAAGGATGAACTGGAACAACACCTTAGTGTTCACAAGATCGAGAGGAGATTTATATGTGGAATCTGTGGTGCTGGCTTGAAACGCAAAGAGCATCTAGAGAGACACAAGCTAGGACACAACCCGGAGCGGCCCTACGTGTGCTCCGTCTGCACCAAGGGCTTCAAGCGACGGGAACATCTCAACCTCCACGCCGTGCTGCACTCCGGGGTCAAGACTGAGATATGCGGAGAATGCGGGAAAGGCTTCTACCGTAAGGATCACCTCCGCAAGCACACACGGTCGCACGAGAGTAAGCGAGCTCGCGAGCAAGCGGACGCGGCCACTGCTGAGAAGCCACAACCTGCCAACAACAATACTTCTAGTATACCCGAGATCACCATTCATATTCCAACGAGTTCAAGCATGCAAGTGCCCATCGAGATAAACATCCCCCAGCACCTCGTGACGTCACTGGCGTCAGCGCAGCAGCAGCAGCAGCAGCAACAAGCACACGAAACACTGGACGCCCTATTGGCCCAACACACCTGA
Protein
MTFGKDYALNFMTCLNNNGQYLFQTMTENRKRSREDDTCEFMPLSKRINNLHINNGLVNTSASQSRDSSQVNSIIIDNGISSPKSKQSSDEDSEMNFATFAAGGAHFVTTGGQLPVTKIQQNVSNNGNSLSQMVGMVGGVTMGEGGMQYVRSLDGGTSLQPTPQLISVPIALPGVKPGDPQPTVQIQVLNPNLLQTQQQPKYHMQIPIQGLQNGAVLTLAYSPETNDAGTLQLVGQNSLGEGLQVLTALSPDLQVIQPSQTRTHDSEHNQPTMHQVFITPNQQIIINGPDKALNNNTDNNNPNITNITIKEECEENIDDESSQGTETSDSMSYPSNPSDEALLIKYLNQFPQEKQSLPASLQQFLRLKHTEAKKQMIEVEVPPEHDKTVEAVAEAILSEDGTLRIKSKKRKKYKKKPSKPARPKPGQVVIATAADGTPIYCCPECQMAYREKDELEQHLSVHKIERRFICGICGAGLKRKEHLERHKLGHNPERPYVCSVCTKGFKRREHLNLHAVLHSGVKTEICGECGKGFYRKDHLRKHTRSHESKRAREQADAATAEKPQPANNNTSSIPEITIHIPTSSSMQVPIEINIPQHLVTSLASAQQQQQQQQAHETLDALLAQHT

Summary

Pfam
PF00096   zf-C2H2
Interpro
IPR036236   Znf_C2H2_sf        + More
IPR013087   Znf_C2H2_type       
SUPFAM
SSF57667   SSF57667       
PDB
5EI9     E-value=5.87661e-21,     Score=251

Ontologies

Topology

Length:
626
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.06931
Exp number, first 60 AAs:
0.04725
Total prob of N-in:
0.00403
outside
1  -  626
 
 

Population Genetic Test Statistics

Pi
266.817558
Theta
162.198827
Tajima's D
2.663421
CLR
0.541029
CSRT
0.95955202239888
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号