SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10150  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA005634
Annotation
PREDICTED:_protein_shuttle_craft_[Bombyx_mori]
Full name
Protein shuttle craft      
Transcription factor
Location in the cell
Extracellular   Reliability : 3.034
 

Sequence

CDS
ATGACAACAATACCAAAAGACAAACGCAAGTCGTGCACGGATCCGATCCCGCTGTGCGGAAACATCTGCGCCAAGCCGCTGCCCTGCGGCCCGGCCGGTGACAAGCATTTCTGCAAACTAGACTGTCATGAAGGTCCTTGTCCAGTTTGTCCTGACAAGACCTTACTGCCATGCCGCTGTGGTCATTCGAACCGCGAGGTTCCGTGCGCTGAGCTACCGGATATGTATAACAATGTGTTCTGTCAGAAGAAATGTAATAAGAAACTGTCGTGCGGTCGGCACCGTTGCCGCGCGTGCTGCTGCGCGGACCCGCAGCACCGGTGCGGGCTCGTGTGCGGGCGCTCGCTCGCCTGCCAGACGCACCGCTGTCAGGACTTCTGCCACACCGGACACTGCGCGCCGTGCCCCACGCTCAGCTTCGAGGAGCTGAGCTGTACGTGCGGGCGCGAGGTGCTGCTGCCGCCCGTGCGCTGCGGCACGCGGCCCCCGCCCTGCAGCGCGCCGTGCCGCCGCGCGCGCCCCTGCGGGCACGAGCCGCTGCACTCGTGCCACACCGGGGACTGTCCGCCCTGCGTCGTGCTCACCACCAGGACCTGCCACGGCGGACACGAGGAACGAAAAACCATCCCGTGTTCGCAAGAAGAGTTCTCGTGCGGCCTCCCGTGCGGCAAACCTCTCCCTTGCGGTAAACATACCTGCATCAAGGTCTGTCACAAGGGACCGTGCGATGCCGGCAAGTGCACCCAGCCGTGCAACGAGAAGCGTGCGAGCTGCGGGCACCCGTGCGGCGCCGCGTGCCACTCCGGCGCGGCGGGCGGCGCGGGCGCGCTGTGCCCGAGCGCGGCGCCGTGCCGCCGCACCGTGCGCGCCACGTGTCCCTGCAAACGGAAATCGGCCGAGAGACCCTGCTTCGAAAACGCACGAGATTACGATAAAATGATGAGTGCTCTTGCGGCCACCAAGATCCAAGAGGGAGGCTCTGTTGACTTGTCCGACGCACAGCGCGCCGTCAATATGCTCAAAACGCTGGAGTGCGACGACGAGTGCCGCGTGGAGGCGCGCACGCGGCAGATGGCGCTGGCGCTGCAGATCCGCAACCCGGACGTGTCCGCCAAGCTGGCGCCGCGCTACAGCGAGCACGTGCGCGCCACCGCCCAGCGCGAGCCCGCCTTCGCCTACCACGTGCACAACCAGCTCACCGAGCTCGTGCACCTCGCCAAGAAGTCGAAACAGAAGACTCGCTCGCACTCGTTCCCGTCGATGAACAGACAGAAGCGGCAGTTCATCCACGAGCTTTGCGAGCACTTCGGCTGCGAGAGCGTGGCCTACGACGCGGAGCCCAACAGGAACGTGGTGGCCACTGCCGACAAGGAGAAGTCGTGGTTGCCGGCGATGAGCATAATGGAAGTGTTGTCGCGTGAGGCGGGCCGGCGGCGCGTGCCCGGCCCCGTGCTGCGGACCGCGCACTCCTCCGCCGCCTCTTCAGCCTCGACGACCTCCTCCTCCGCCGCTAACAAGTAA
Protein
MTTIPKDKRKSCTDPIPLCGNICAKPLPCGPAGDKHFCKLDCHEGPCPVCPDKTLLPCRCGHSNREVPCAELPDMYNNVFCQKKCNKKLSCGRHRCRACCCADPQHRCGLVCGRSLACQTHRCQDFCHTGHCAPCPTLSFEELSCTCGREVLLPPVRCGTRPPPCSAPCRRARPCGHEPLHSCHTGDCPPCVVLTTRTCHGGHEERKTIPCSQEEFSCGLPCGKPLPCGKHTCIKVCHKGPCDAGKCTQPCNEKRASCGHPCGAACHSGAAGGAGALCPSAAPCRRTVRATCPCKRKSAERPCFENARDYDKMMSALAATKIQEGGSVDLSDAQRAVNMLKTLECDDECRVEARTRQMALALQIRNPDVSAKLAPRYSEHVRATAQREPAFAYHVHNQLTELVHLAKKSKQKTRSHSFPSMNRQKRQFIHELCEHFGCESVAYDAEPNRNVVATADKEKSWLPAMSIMEVLSREAGRRRVPGPVLRTAHSSAASSASTTSSSAANK

Summary

Similarity
Belongs to the NFX1 family.
Keywords
Alternative splicing   Complete proteome   DNA-binding   Metal-binding   Nucleus   Phosphoprotein   Reference proteome   Repeat   RNA-binding   Transcription   Transcription regulation   Zinc   Zinc-finger  
Feature
chain  Protein shuttle craft
splice variant  In isoform B.
EMBL
BABH01020191    BABH01020192    NWSH01000227    PCG78214.1    PCG78213.1    ODYU01001380    + More
SOQ37468.1    RSAL01000090    RVE48091.1    KQ461155    KPJ08291.1    KQ459232    KPJ02641.1    AGBW02013517    OWR43279.1    KC469893    AGC92703.2    FP102340    CBH09293.1    KQ971343    EFA04758.2    KYB27326.1    PYGN01000208    PSN51156.1    GECZ01027838    JAS41931.1    DS235093    EEB11835.1    GECU01009311    GECU01006610    JAS98395.1    JAT01097.1    NEVH01014379    PNF27624.1    PNF27625.1    GEBQ01027027    JAT12950.1    KQ978220    KYM96321.1    GEDC01016725    JAS20573.1    AJVK01033236    AJVK01033237    KZ288427    PBC25866.1    GEZM01096724    JAV54622.1    GAMC01020057    GAMC01020055    JAB86498.1    GBHO01040188    GBHO01007510    JAG03416.1    JAG36094.1    KQ414614    KOC68840.1    GALX01003148    JAB65318.1    GBHO01007718    GBHO01000278    JAG35886.1    JAG43326.1    GDHC01011747    JAQ06882.1    JRES01000305    KNC32491.1    CH940650    EDW66643.2    AJWK01019755    KA645427    AFP60056.1    CP012523    ALC39716.1    CH477223    EAT47205.1    DS231821    EDS44970.1    GAKP01015839    JAC43113.1    CH963913    EDW77484.2    GAPW01000154    JAC13444.1    GFDL01009011    JAV26034.1    GFDL01009855    JAV25190.1    GFDL01009025    JAV26020.1    CCAG010018380    JXUM01028608    JXUM01028609    JXUM01028610    KQ560826    KXJ80724.1    JXJN01013499    KQ760869    OAD58748.1    GBXI01007360    JAD06932.1    BT125955    ADX35934.1    CH379058    EAL34416.2    CH479184    EDW37055.1    OUUW01000040    SPP89929.1    GDHF01018212    GDHF01005212    JAI34102.1    JAI47102.1    SPP89928.1    CH902620    EDV31856.1    CM000157    EDW89773.1    CH940649    EDW63647.1    CH954177    EDV58003.1    ALC39723.1    CH933807    EDW11771.1    GGFK01006000    MBW39321.1    ADMH02000386    ETN66754.1    AE014134    AGB92995.1    U09306    AF145679    AGB92996.1    CM002910    KMY90342.1    KMY90343.1    GDIP01115026    JAL88688.1    CH480818    EDW51806.1    GDIP01055985    JAM47730.1    GL732581    EFX74683.1    GDIP01074037    JAM29678.1    CH916368    EDW02849.1    GDIP01207964    JAJ15438.1    GDIP01208014    JAJ15388.1    GDIP01047087    JAM56628.1    GDIQ01254719    JAJ97005.1    GDIQ01172193    JAK79532.1    GDIP01206262    JAJ17140.1    LRGB01001005    KZS14152.1    GDIP01206263    JAJ17139.1    GDIP01139280    JAL64434.1    GDIQ01102271    JAL49455.1    GDIQ01004668    JAN90069.1    GDIP01158477    JAJ64925.1    ATLV01014599    KE524975    KFB39190.1    GDIP01016661    JAM87054.1    GDIP01127222    JAL76492.1   
Pfam
PF01424   R3H        + More
PF01422   zf-NF-X1
Interpro
IPR034076   R3H_NF-X1        + More
IPR034078   NFX1_fam       
IPR001374   R3H_dom       
IPR019787   Znf_PHD-finger       
IPR036867   R3H_dom_sf       
IPR019786   Zinc_finger_PHD-type_CS       
IPR001841   Znf_RING       
IPR000967   Znf_NFX1       
SUPFAM
SSF82708   SSF82708       
Gene 3D

Ontologies

Topology

Subcellular location
Nucleus  
Length:
506
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00172
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01814
outside
1  -  506
 
 

Population Genetic Test Statistics

Pi
169.893641
Theta
166.578405
Tajima's D
0.263486
CLR
0.691588
CSRT
0.444977751112444
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号