SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10084
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.284
 

Sequence

CDS
ATGGAGTTTTCTCCAACCAACACACTGCTCGCGGAATTCTTAAGCGAGAAATACCCGGCCCTCGAATCAGAATTTTTAGCTTACAAAGCTAAACGCGCCGTGAACTGTTCTGCCGTGCCCGCCGCGCCCGTCGTTTCCGCCACGCCTGCCGTTCCCGCGTCCCCTGCAAGCGCGCGCAAAACTCCCGCGCCGTACACCGCAGCCTCCGTCGCGCCCAGCACACCCGTGTCCCCCATACTGTCGCGAAAAACTCCCGCGTCTACCGCGGCAGCTTCCATTCTACCTCAGCGATCATCTGCGGCTTCCGTCGCGTCCGCCGCTCCCGTGCCTTCCTCCTCGTCCTCCGACTCTGACTCGGATATGGAGGTTGACCTCGTTCCCGCCTCATTAACAGATGGATTCACCCTCGTGCAAAAGGGTAAGAAGCGTGCCGCGGAGTCCCGAGCTTCCGCGGCCGCTAAAATAAGCAAAGCCGCGAACGCGTCGCGCCCCCGCCCTCCGACCCCCGTCGCTCCCTGTCCCCGTGCCACGCCGTCGCCGCGCCCGATGGCACAAACGAGAAATCAGGCCCCTCCTCCGTTGATTCTTCAAGAGAAGGCTGCTTGGGACCGTGTCTCCCTGGCCCTTAAGGCCAAGAACATAAATTTTGTCAGTGCCCGTAACCTCGCGAACGGGATACAGATAAAAGTAGCAACACCCGACGACCATAGGGCCCTCTCAAGCTACCTCCGAAAGGAGCGTATAAGTTATCATACGTATACGCTCCAGGAGGAGCGTGAGCTCCGTGCAGTCATACGTGGCATCCCCAAGGAATTAGATGCCGAGCTCGTAAAGGCCGACCTACTCGAACAAGGCCTACACGTAAACTCCGTGCACCGCATGCACACAGGACGCGGGAGGGAGCCATACAATATGGTTCTCGTTGCCCTCCAGTCTACCCCCGAGGGAAAGCAAATCTTTAACGTTCGAACGTTCACTCCGAATGTCTCTGCACCCTCGATGGTTGCATTCCATCGTGAGGTGTCAGAGGGTGTAATCCAATTCCTCAAACCGGAATCGCCGGGAGTCGAGCTGGGAGATGACGACTTAGTCACTCCCAGCGAGGTGCGCCTCCTCATCAAGTTGATGAAGAGGCGCAAAGCCCCCGGCGAGGACGGTATTCCTCCCCTCGCCTTGCAAAACCTCCCTCCCTCAATCGTGTCAGCAATGACACGATTGTTTAATTCCATTCTCCGGGTAGGACACTTCCCTGGAACTTGGAAACTGGGCAAGATCATCGTCTTGCCCAAACCCGGCAAGGACAGGAGAAAGCCCTCCAGTTACCGACCGATTACCTTGCTCTCGCACGTGGGCAAGTTGTTCGAGCGGCTGCTCCTGAGGAGAATATCGCCGTATATTCTCCTCAGGCCGGAGCAATTCGGCTTTAGAAGCGGCCACTCGACGACTCTGCAACTGACCCGTGTCCTGCATCACTTGGCAGACCGGCGAAACTCGGGCCAATACACGGTCGCGGTCCTTCTCGATATCGAGAAGGCCTTCGACCGTGTGTGGCACGAGGGGCTGGTCCACAAGCTGCGGGACGCGGGCCTACCGCACGCTCACGTGCGACTGCTCGGGTCGTATCTGGAGGGCAGAACCTTCTTTGTCGCGGTCGAGGGCGCACGGTCTTCCGTGCGTCCCATTACGGCCGGGGTTCCCCAGGGTAGTGTCCTATCACCTATCCTATACGCCCTCTACACCAACGACATCCCCACCCTGGAGGGTCACCTTCGGGCGTGGGAGGAGGACGTGAAGTTGGCCTTGTTCGCTGACGACTCGGCCTACTTCTCGTCCTCTCCGTTCCCCTCTGCAGCCATTATGAGGATGCAGAGGCTTTTGGATTTACTGCCCCAGTGGCTGGACCGTTGGAGAGTCGCGGTCAATGTGGGAAAGACCGCGGCCTTACTCTACGGTCCGGTCCGTATCAGAGTCGTCCCAAAGAAACTCAGCCTCCGAGGTGTGAATGTCGAGTTCAGGACCACGGTCCGGTATCTCGGATGCGACATCGACCGCTCCTTGAGCATGGTCGCGCACGTCAACCGAGTCATCGGTCAGACTCGCGCGACCAGGTTCTTGTTGCGGCCGGTGTTTGCGTCCGGGCTTCCGACCAGGACCAAACTCGCCATTTACAAGACATACGTCCGTTCCCGCCTCACATACGCTGCTGTGGCCTGGTATCACCTGTTGTCGCCGTCCCAGCGATCTAGGTTGCAGGCCCAGCAGAGTCTTTCCCTCCGCATTGTCGTCGGGGCCGGGCAGTACGTCAGAAATGACGTTATTGCCCGGGACCTAGGTGTGGAGTCGCTCGTGGAGTTTGTGACTAGGCTCGCCCGTAATATGTACGAGCGAGCCGAAAACGGGCCCCATGAGCATCTCCACAACATAGCCCCGCTGCACGCCAGACCACCGGATGGTACGGCGTTGCCGCGGGAGCTATTGGAGAGCAGCAGCCGCCCCCGGAAGAAGGGAGAGGAAGAAAGAAGAAGAGAAGAGAAGAGTGAAGAAGGAGACGAAGAAAGAAGTCGACCCCACACACATCTTCAATCCTGCCTGATACTCCATCCAGCAGCGCATCACCCCTGCCTTATTAGGCAGGGAGCTACATGTCCGGGCAGAGGGGTTTCCCCGAGGCCCGCTCCGTGCCCCCCCAAAGGGGGTACGACGACCCCACGACTGCGCCAAAACCACCTCCGAGCTTCCGGCCCTGACATCAAAGCCACGGCACCCTCTGTGCCGAAGGCTAAGCCTGCCTTCGTGCCGGCGCCGGTGCCCAGCGGCTCGGCCTGGGCTAAACCGTTGCCGTACACGAACACGGCTGTAGCTCCCTCCCCCGCGATTCGTCCCGCCCCCGCGATACGTCCCTCCCCCGTGATTCGTTCCTCCCCCGCGACCAGCACTCCGACCGCGTCCGACAATCTCGCTCTAGCGATCGACTTTTTTCAGTCGATCAACTTTGAGCGTGTTAATGCTTTGGGTGACGCCATTCGCGCCGCCTCCACTGCACAACACTTCATCGCCGCTGTGCAAGAATACGCTGACGAGACCCTGCTTAAGCCCGCGCGCCGCGACCCTAAAATCGCGAACTATAACATGGTTAGGAACGACAGGCTCACTGCTCGTGGTGGTGGTACCGTCATTTACTATAGACGAGCCCTGCACTGCGTCCCACTCGACCCCCCCGCGCTCGTTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGCATGGGAAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACGTCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTACGTTCCAGTCACGAGGACTGTAGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAGCCCGGACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCATCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCACGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTTAATGCCGCTATGGCGAACTGTATATTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACTCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGTCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCTGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGCCAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCTAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTACAACCTAA
Protein
MEFSPTNTLLAEFLSEKYPALESEFLAYKAKRAVNCSAVPAAPVVSATPAVPASPASARKTPAPYTAASVAPSTPVSPILSRKTPASTAAASILPQRSSAASVASAAPVPSSSSSDSDSDMEVDLVPASLTDGFTLVQKGKKRAAESRASAAAKISKAANASRPRPPTPVAPCPRATPSPRPMAQTRNQAPPPLILQEKAAWDRVSLALKAKNINFVSARNLANGIQIKVATPDDHRALSSYLRKERISYHTYTLQEERELRAVIRGIPKELDAELVKADLLEQGLHVNSVHRMHTGRGREPYNMVLVALQSTPEGKQIFNVRTFTPNVSAPSMVAFHREVSEGVIQFLKPESPGVELGDDDLVTPSEVRLLIKLMKRRKAPGEDGIPPLALQNLPPSIVSAMTRLFNSILRVGHFPGTWKLGKIIVLPKPGKDRRKPSSYRPITLLSHVGKLFERLLLRRISPYILLRPEQFGFRSGHSTTLQLTRVLHHLADRRNSGQYTVAVLLDIEKAFDRVWHEGLVHKLRDAGLPHAHVRLLGSYLEGRTFFVAVEGARSSVRPITAGVPQGSVLSPILYALYTNDIPTLEGHLRAWEEDVKLALFADDSAYFSSSPFPSAAIMRMQRLLDLLPQWLDRWRVAVNVGKTAALLYGPVRIRVVPKKLSLRGVNVEFRTTVRYLGCDIDRSLSMVAHVNRVIGQTRATRFLLRPVFASGLPTRTKLAIYKTYVRSRLTYAAVAWYHLLSPSQRSRLQAQQSLSLRIVVGAGQYVRNDVIARDLGVESLVEFVTRLARNMYERAENGPHEHLHNIAPLHARPPDGTALPRELLESSSRPRKKGEEERRREEKSEEGDEERSRPHTHLQSCLILHPAAHHPCLIRQGATCPGRGVSPRPAPCPPKGGTTTPRLRQNHLRASGPDIKATAPSVPKAKPAFVPAPVPSGSAWAKPLPYTNTAVAPSPAIRPAPAIRPSPVIRSSPATSTPTASDNLALAIDFFQSINFERVNALGDAIRAASTAQHFIAAVQEYADETLLKPARRDPKIANYNMVRNDRLTARGGGTVIYYRRALHCVPLDPPALVNIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHVRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDYVPVTRTVVDWHTLGISLAESDPPSLPFSPDSTPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLTAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKLGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSLPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPGNRTRRTRQRGRRTT

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=3.88263e-06,     Score=127

Ontologies

GO

Topology

Length:
1942
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.25138000000001
Exp number, first 60 AAs:
0.01092
Total prob of N-in:
0.00053
outside
1  -  1942
 
 

Population Genetic Test Statistics

Pi
217.19589
Theta
156.441963
Tajima's D
1.726478
CLR
0.290216
CSRT
0.831858407079646
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号