SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09113
Annotation
S08405_hypothetical_protein_2_-_silkworm_transposon_mag
Location in the cell
Nuclear   Reliability : 2.502
 

Sequence

CDS
ATGTCGGTCGGGCAGTTGAAAGAATTCGCGGTAAACAGTGGAAATTGGTCCTCATATGTTGAGAGATTAGAAATGTACTTCTTGGTGAATAAAGTGACTGACGATTTAAAATTACCCACATTAATTTCCGTTATGGGTGAGGAAGCGTACGATTTATTATCGACATTAGCCAGCCCTTCGAAGCCGTCACAGTTAACTTATGCTAATGCCGTGGCGATGTTGGCAGCTCACCTGCAACCGAAGCCCTCAATCTTGGCGGAAAGATACAAGTTTCGACAACGTCGGCAGCTGAATGAGTCAATAGCTGACTACGTCACAGAATTAAAAAAATTATCAAAAAATTGTGAGTTCGGCTCGTCGCTGGATGAAAATCTGCGTGATCAAATGGTTTGTGGATTAAAGAGCGAAATCATACGGCAAAGGTTATTTGCCGAGGAGAAATTAGAATATAAGCGAGCAGTTACGTTAGCTTTGTCTTTAGAAGCTGCGGAGAGGGATGCGATTGCAGTGGAACGTACGCCAATTGAGGAGGTTAACAAAATTAACTTCAATGAATGTTCAAGATGTGGAGACAGGAGACACCAAGCAAAGGATTGCATATACAAAGACTACGTGTGCAGTTCATGTCATGAAACCGGCCATCTACGAAGAATGTGCCCCAAAAAAGGGCTTAAGAACCAGGCGGAGGCAGCCGGGGGTTCACCATGCACCGGGCGCCGGGGGAACCGGGGTGCAGGCGGCAACAGGCGATCGTGGCGCGGGCAGCGCGGTGCGGGACGAGGAGGCCGAGAGCGGGCTCCTTTGCACTTATTATACGATCAAAACAACGATGACACATACAACAACTTCAATAATGAACAGGACGGGTGTGGAGAAGAAAATGAGCCTATGTACCAAATGACATTGAGTAATTATAAACCGGTGTGTATTAAAGTTAAAGTCCAAAATTGCTTGCTCAAGATGGAGGTCGATACTGGATCGGCGTTATCTTGTATTAGCAAGAATGTTTATGATAAATATTTTTCTAAGGAGAAGTTACAGGCATGCTTATTAAATTTAAAATTTTACGATGGCTCAATCATTCGGCCTTTAGGGTTTATAAACACTATAGTGAAGTACCAAGGTGTTTCAAAAATGTTAGACTTGTATGTCATAGACAAAGGAACGACTAATCTATTGGGCCGACAATGGTTAGCTGAATTGAATATTCCTATAAAAATATCAAAACCTACGAGTTTTAAAATACAACACAGTAACTTTGTAACCGAACACGCACGAGACTATAATAAATTAATTAATGAAATTGTTTCTAGACATAAATCCTTGTTCGACGGCACATTGGGTAAATATACGGGGGGCACAGCAGAGTTAATCGTGCGGCCGGATGCGGTGCCTATCTACTGCCGCGCGCGACCGCTGCCGTATGCGCTGCGCGAGCGCGTCGATGCCGAGCTCGACGCGATGCTGGCCGCCGGCGTCATCAAACCGGTGGACCACTCCGACTGGGCCACGCCACTTGTCGTAGTACGCAAAGCGGACGGCGGTCTGAGAATATGTGCGGACTATAAGGACCTAGACAGTCATTTAAAGTCTATAAAAGAAGTATTAGATATATTAGAAAGGTATGGCTTAAAAATTAAAAGGAGTAAGTGCGAGTTCATGGTAACAGAAGTGAGGTATTTAGGGTTCATAATAGATCAAAATGGGGTTCGTGTAGACCCAGAGAAAGTCAAATCAATAGCAACAATGCCACACCCAAATAACGTGACAGAATTAAAATCTTTCATCGGATGTATAATGTGGGGTCATCGTGTGGTTATACCCTCTTCATGCAGAAACAAAATAATAACGGAGCTTCATGATCCGCATATGGGCATAGTGAAAACAAAATCGCTAGCACGTAGTTACGTTTGGTGGCCGGGAATCGACGAAGCGCTCGAGACGGAATGTCGCGCTTGCACCGTGTGTGCTGCCGTCGCAGACGCACCTTCTACACACGCGCCCCGCTCGTGGCCCTGGCCCTCACGCCCCTGGTCCAGGTTACACTTAGACTTCTTAGGCCCCATAGGTGGAGTCACTTATCTAGTTGTAGTGGATTCATGCTCCAAATGGATAGAGGCAATTAAAATGCAGAGGACAACGGCACAAGCGGTTATATCGGTACTGCGGGACTTGTGGTCAAAATTCGGCCTGCCAAAGCAAACGGTCAGTGACAATGGACCGCCTTTCTCGAGCTCTGATTTTCAGAAGTTTCTGATTCATAATGGCATAAAACATATTTATTCAGCTCCCTATCATCCCGCCTCTAATGGGGCCGCTGAAAATGCAGTTAAAATTTGTAAACGTGCGATTAAAAAGGCATTAAAACAGAATTTAAACGTAGATACAGCTCTGTGTAGATTTTTATTAGCCTACAGAAATACAGAACATGCAACTACCGGCGATAGTCCAGCCAATATATTACAGGGTCGAAGTCTCCGTATGAGATTAGATAATTTAAAACCAGAAAGGCAATCTCGAGTTATCGCGCAACAAGAGCGGAGCGAGCAAAACGCAGGGGGTGTGCAGCGACAACTCGAGCCGGGCACTAAGGTGTGGTATCGGGATTATCGAGGTCTGGATAAATGGGTACCTGGGACGATCCTCAAGCAATTAGGTAGTCGTGATTACTGTGTACGATCTAGTTTTGGAACCGAGAATCATAGGCACGTCGATCAGCTAAAATTAAGGGTTACAAAAAATATAGATAAAGTTGATACCTTTGCGTCGATTCGTAAAAATATAAGTCCCGAACTGATCGCGCAAAATTTAGACTTAAGAACACAATCACGTAAGTCGCTATCATTTCCCATGACAAGTGGCGAGGAACCAGTGGCGGTGGTCAACGATTCGGGGAAGAGTAGTTCACCACCAAAAAATAGCACACCGGCACAGGATGCTGTATCGCCTATTCGTGGCAGCCCTATGAGACCCGCTGTGCCGATAGACAAGGCAGCATGTAGTACTGGTGGTAAGAGTATCAATGAAAATGTGACACCCAAACGTGAACGTCCTGTAAGAATACGCAAGCCACCAGTTAGATATGGATTCGAGGAAATAGATTAA
Protein
MSVGQLKEFAVNSGNWSSYVERLEMYFLVNKVTDDLKLPTLISVMGEEAYDLLSTLASPSKPSQLTYANAVAMLAAHLQPKPSILAERYKFRQRRQLNESIADYVTELKKLSKNCEFGSSLDENLRDQMVCGLKSEIIRQRLFAEEKLEYKRAVTLALSLEAAERDAIAVERTPIEEVNKINFNECSRCGDRRHQAKDCIYKDYVCSSCHETGHLRRMCPKKGLKNQAEAAGGSPCTGRRGNRGAGGNRRSWRGQRGAGRGGRERAPLHLLYDQNNDDTYNNFNNEQDGCGEENEPMYQMTLSNYKPVCIKVKVQNCLLKMEVDTGSALSCISKNVYDKYFSKEKLQACLLNLKFYDGSIIRPLGFINTIVKYQGVSKMLDLYVIDKGTTNLLGRQWLAELNIPIKISKPTSFKIQHSNFVTEHARDYNKLINEIVSRHKSLFDGTLGKYTGGTAELIVRPDAVPIYCRARPLPYALRERVDAELDAMLAAGVIKPVDHSDWATPLVVVRKADGGLRICADYKDLDSHLKSIKEVLDILERYGLKIKRSKCEFMVTEVRYLGFIIDQNGVRVDPEKVKSIATMPHPNNVTELKSFIGCIMWGHRVVIPSSCRNKIITELHDPHMGIVKTKSLARSYVWWPGIDEALETECRACTVCAAVADAPSTHAPRSWPWPSRPWSRLHLDFLGPIGGVTYLVVVDSCSKWIEAIKMQRTTAQAVISVLRDLWSKFGLPKQTVSDNGPPFSSSDFQKFLIHNGIKHIYSAPYHPASNGAAENAVKICKRAIKKALKQNLNVDTALCRFLLAYRNTEHATTGDSPANILQGRSLRMRLDNLKPERQSRVIAQQERSEQNAGGVQRQLEPGTKVWYRDYRGLDKWVPGTILKQLGSRDYCVRSSFGTENHRHVDQLKLRVTKNIDKVDTFASIRKNISPELIAQNLDLRTQSRKSLSFPMTSGEEPVAVVNDSGKSSSPPKNSTPAQDAVSPIRGSPMRPAVPIDKAACSTGGKSINENVTPKRERPVRIRKPPVRYGFEEID

Summary

Uniprot
ProteinModelPortal
PDB
3S3N     E-value=2.18733e-10,     Score=162

Ontologies

Topology

Length:
1034
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00872
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00004
outside
1  -  1034
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.190544
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号