SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08720
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 2.523
 

Sequence

CDS
ATGGCTGCATCTCAATCATCCGGCCCCAAACGGCCCTCTATTCAAGCCCAAGTTGCCCCTCCCCCGAGGTCGGGGGGTCGTGCCCAGGTGGACTTACGCCGTCACCCACCAATTGTAGTGGAGGCCCTCCCTAATTGGCCTCGCCATATGGCGGCCATTAGGGAGCGACTCGGCAGAGCTCCCTCGGGGCGACCCTACGGCGCCGGGTTCCTATTTCTCCCGTCATCGATCGAGGAGTACAGGGAGGTCCAGGCCTACCTATCGGAGGTCTCTGCCAGGGACAGTGCCATTAAATGGTACTGTTACGCCCTGGCGGAGGACATTCCTTCGAAGGTAGTTGTTCGGGGCCTCCCTGTCGATACCGATGCGGCCGACGTAACCCAGGCCCTAAGAGAGCTGGGCTTCCCGGCCCGGCATGCCCGATGTATCGAGGCCAGGAGGGGTAGGCCAGGCTGCGTGTTTTTCGTGGCCTTGGACCACCTCTCCAAGGACGACCTCGCCCGCTTGTACGCAGTTGAAGAGCTGCTGTACTTGCCGGGGGTGTCAGTGGAGGGATGGCGTACAAGTCGAGGGCCTGCGCAATGTCATCGTTGCCAGGCCTTTGGGCACGCATCCTCCAACTGCCACCGCGCGGTCCGCTGCGTTAGATGTGCTGAAGAACACGTAGTAGCGGACTGCCCGAGGCCGAGGGATGGCCCGTTTTCTTGCGCCAACTGCGGAAGGGACCACACTGCCGTCGACAGACGGTGCCCGGTCTTCCGCAGAAGGGCAAGGATGATGGGAGTCACCATTCCCCCTCCGGTACCTCGGGCCCCACGGGCCGAATTGCATCCGGCTCCGGTACTCCCGTCCTCATCTCAAGCTCCTAAGGGGAAGGGGAAAGGGAAAGGGAAATCCTCCCAGCCCCAACCCCCTCCCCAGTCCTTGATCATCCACCCAGCCGTTGTGGTAGAGGCCAAGCCGTCAGCGGCAACGCTGATGGCAGAAGCCAATACTCCGCGGCAGGGTCCTAAACCTCAACCTGCCCCCCGCAGTACTGTCGCTGCCAGTCTTTCACAGCCAGTAAAACAAAACCAAAAGGCCCTAAAAAATAAATTAAAGAACAGGAAGAAAAAAGAAAGAAGAAAGCTCCAAAAACAATTACTTGTAGCTGAAGTCCTCCCTCTATCTGCACCAATTGCACCAAATTCTACGACTATGGAGGTCGATATTAATCCTTCCCAAACGATTGAGAACCAAGCCAACGATCCATTGCCTGAGCCTGGGGAAATTTTGCCTCAGACCCAGCCGGATACATCTCAGCCCCCTCTTCCCCCCCGCCCTCAGCGCGAGCGGCGCAGCGGTCGTTCAATGGCTAGCCAGGAACTGCGCATCATTTATTGGAACCCCGGCGGGGTAAAAACCCGCAAGAACGATCTCTTGGTTCTCGCCCGGGAGTACAACCCTGAGGTTGTGCTCCTGGGCGAGACCAAGCTACGTCCTCGGGATGTGTTCAGGATTCCAAACTACTTCATGTACCGACGTGACGAGGTGAGTCCTGCTGGGACGCCGTTCAGGGGCACTGCGGCGCTCGTCAGGCGAGACGTGGTGCATGATCAGTTGGATTTGTTGGCCTTCACATCGACAAGGTCGATCGGTGTGAGGATCCACACCTCGGGGGGAGATATGCGGGTTTATGCCGCGTATAGACCCCCGGGGCCTGATTTCCACCCCGGGGACATAAGACGGGTCCTGAATTGCGACAGCCGCCCAGCTCTGCTGGTCGGGGACCTCAACGCGAAGCACGTCGCGTGGGGCTCCCGACTGAACTCAGCAGTGGGCAGGCGGCTGTTAGAAGATGCCGATAGGGGCGACTACTCTGTGGTCGGCCCCGACGAACCCACGCACATTCCGACCGCCGCGCAACTCCAGCCCGACGTGTTGGATGTGTGCGTTCATAAGGGGCTACGGTGCCCCTTAACTATTGAGGCACTGTACGACCTGGGTACCCCCCATCTCCCTATCCTGGTCACACTGGGAATGGGGCTTACCCGGGTTGCGACCTCGCCCCTACGACCGAAGGTCGACTGGGAGCTCTTTAAGAGACTCCTAGTTGACCTTCCCGTAATTCAGGACCCCAACACCCCTGAGGGGGTCGACGACGCGGCAGTCCGCCTTGTCGACTCCATCAGGGGAGCGATCGACCAGGCAACGACTCTTGTGCCCAGCGGCGGGCCCAGAGGTATACTCCCGGCCCATCTGAAAGCGATTATTCGCCGGAAGAGGGGCCTGAGGAGGCTCTGGGCGACAACTCGTTGTCCCAGGATCAAGCGCGAGCTTAATGAGCTGGAAGCGGAGTTGGCGGCGAAGATTAGCTCCTATCGGGGCTATGCGTGGGAGGAACGGATCGAGGAGGCCCGTGAGGACCCCTCGTCCGTGTCCCTCCACCGACTTTGCCGCCAGCTCTCAAATCGGCCTGCCCCGACTTGTCCACTCGTGGACGAGAGGGGCAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATGTCCTGGCCGTAATGCTGGAGCGGCAGTTCGCTCCAAATAACTCTGCACCCTCAGAGGCCGCATTCCACCAATCGGTGGAAGAGAGCGTAGCAAGCCTACTCTCCTCCCCGGTGCCACCGTTGGGAGATGGTGATTTCATCACTCCCAGTGAATTGCGCCTCTCCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGCGAGGACGGTATTCCCTCCCTCGCATTTTTCCACTTCCCCGAAACGGTCGTGTCATTCATGACACGACTGTTCAATTCCATTCTGTCCACAGGACACTTCCCGGGAACTTGGAAATTGGGTAAGGTTATTGCCCTGCCCAAACCCGGCAAGGATAGGAGAAATCCCTCCAGTTATCGTCCGATCACTCTGCTGTCGCATATGGGCAAGTTGTTCGAGCGGCTGCTGCTGAGAAGGGTGTCGCCGCACATCCTTCTCAGACCCGAGCAATTCGGGTTTCGCAGCGGTCACTCGACAACGCTGCAATTGGTCCGCGTTATGCACCACTTGGCGGATCGGTCCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGATATCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGATCTACAAGCTGTTGCGGAACACGGACCTCCAGCACGCCTATGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCCTTGTCGCGGTCGAGGGCGCAAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCCCAGGGAAGCGTCCTGGCACCAGTCCTCTACGCTCTCTACACCAACGACATTCCCACGCTTGAGGGCAACCTCCAAGCGTGGGAAGCCGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCTCGTCCTCTAATTTCCCCTCTGCGGCCATTTCGAGGATGCAGAGGCTGTTGGACCTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACCGCGGCTATCCTCTTCGGTCCGGTCCGCACAAGAGCCGTCCCAGGACAGCTCAGTCTCCGTGGAGTCAATGTCGAGTTTAGGCCCAGTGTCCGATACCTGGGAGTCAATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAAGTCGGCGTTGGCGGCCGCCCGCTATGCGAGGTTTCTCCTCCGGCCGGTGTTGGCCTCCAGGTTGCCGACCAGGACTAGACTCGGCATTTACAAGACGTATGTTCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGATCATGCGGGTGAAGTTACAGGCCCAGCAGAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGAAATGACGTAATCGCCCGGGATCTAGATGTGGAGTCGCTCGAGGAGTTCATCCGGAGGCTAGCTCGTAATATGTACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTCAGGCGCTACCAAGGGAGCTACTGAAACCCCCGGCTATGGATAATATCTCCTTGGAATTTGCCGCTGTTCTCCTCAGGGTTGGCCAGAGGATTGGTCATGGTTCTCGCGGCGAACTGAATCCCATCGCCTGCGGAAACAATAGTTCGCTTGAACCACATTAA
Protein
MAASQSSGPKRPSIQAQVAPPPRSGGRAQVDLRRHPPIVVEALPNWPRHMAAIRERLGRAPSGRPYGAGFLFLPSSIEEYREVQAYLSEVSARDSAIKWYCYALAEDIPSKVVVRGLPVDTDAADVTQALRELGFPARHARCIEARRGRPGCVFFVALDHLSKDDLARLYAVEELLYLPGVSVEGWRTSRGPAQCHRCQAFGHASSNCHRAVRCVRCAEEHVVADCPRPRDGPFSCANCGRDHTAVDRRCPVFRRRARMMGVTIPPPVPRAPRAELHPAPVLPSSSQAPKGKGKGKGKSSQPQPPPQSLIIHPAVVVEAKPSAATLMAEANTPRQGPKPQPAPRSTVAASLSQPVKQNQKALKNKLKNRKKKERRKLQKQLLVAEVLPLSAPIAPNSTTMEVDINPSQTIENQANDPLPEPGEILPQTQPDTSQPPLPPRPQRERRSGRSMASQELRIIYWNPGGVKTRKNDLLVLAREYNPEVVLLGETKLRPRDVFRIPNYFMYRRDEVSPAGTPFRGTAALVRRDVVHDQLDLLAFTSTRSIGVRIHTSGGDMRVYAAYRPPGPDFHPGDIRRVLNCDSRPALLVGDLNAKHVAWGSRLNSAVGRRLLEDADRGDYSVVGPDEPTHIPTAAQLQPDVLDVCVHKGLRCPLTIEALYDLGTPHLPILVTLGMGLTRVATSPLRPKVDWELFKRLLVDLPVIQDPNTPEGVDDAAVRLVDSIRGAIDQATTLVPSGGPRGILPAHLKAIIRRKRGLRRLWATTRCPRIKRELNELEAELAAKISSYRGYAWEERIEEAREDPSSVSLHRLCRQLSNRPAPTCPLVDERGNRCFSAQARADVLAVMLERQFAPNNSAPSEAAFHQSVEESVASLLSSPVPPLGDGDFITPSELRLSIKRMKRRKAPGEDGIPSLAFFHFPETVVSFMTRLFNSILSTGHFPGTWKLGKVIALPKPGKDRRNPSSYRPITLLSHMGKLFERLLLRRVSPHILLRPEQFGFRSGHSTTLQLVRVMHHLADRSNARQYTAAVFLDIEKAFDRVWHAGLIYKLLRNTDLQHAYVRLLGSYLEGRSFLVAVEGAKSSVRPVTAGVPQGSVLAPVLYALYTNDIPTLEGNLQAWEADVKLALFADDSAYFSSSNFPSAAISRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTRAVPGQLSLRGVNVEFRPSVRYLGVNIDRSLRMTAHAKSALAAARYARFLLRPVLASRLPTRTRLGIYKTYVRSRITYAAAAWYHLIPQIMRVKLQAQQNLALRTIVGAGRYVRNDVIARDLDVESLEEFIRRLARNMYERADGGPHEHLHNIAPLHARPPDGQALPRELLKPPAMDNISLEFAAVLLRVGQRIGHGSRGELNPIACGNNSSLEPH

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=5.30074e-05,     Score=116

Ontologies

Topology

Length:
1396
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01699
Exp number, first 60 AAs:
6e-05
Total prob of N-in:
0.00006
outside
1  -  1396
 
 

Population Genetic Test Statistics

Pi
282.683614
Theta
188.715951
Tajima's D
1.560115
CLR
1.583494
CSRT
0.793160341982901
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号