SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08414
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Mitochondrial   Reliability : 1.704 Nuclear   Reliability : 1.906
 

Sequence

CDS
ATGATTGCTGGTTCGGGGACGATGGCGGCCATAGCCATAAGAAGAGACGCGGCGATCCCCCCCCTGGCGATGGTGACCAGGGGCCAAGGGTTCGTCGCGGTGCAGTTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAACAGGCCTACTGTCGAGTTCGGGCATTTCCTGGGCGGGATCGGGGCGATTGCTCGCCGCCTCGCTCCCCGTCCAGTGATTCTCGCGAGGGATCTCAACGCGAAGTCTGTCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTACTGGAGAGGTGGGTGAACGCGGCCGGCCTCTGTTTGTTGAATAGAGGTTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCGAGCCCAGCCATCGCACGCCGTATCTGCGACTGGAAGGTTTTGGAGGGGGCGGAGACGCTGTCAGATCACCGATATATTCGGTCGCGCACTAAAGAGGAGCCCCGCCGTCATCCACCTATTATGGTGGAAGTGCTCCCAAATTGGTCCCGCCATATGGCGGCCATCAGGGAGCGCTTGGGGAGGGCACCCTCCGTGCGCCCTTACGGAACAGGGTTCAGATTTCTGCCAGCGTCGGCAGAGGAATATAGAGTGGTCCAGGCCTACCTTGCCGGGGCCTCCTCAGCGGACAGTGCCATCAAATGGTATTGCTACGCGTTGGAGGAGGACATCCCGACAAGGGTGGCTATTCGCGGACTACCTGCCGACACCGACGCGGCAGAAATCACAAATTCCTTGAAGGAGCTGGGGTTTCCGGCTCGCTATGCCCGATGCATACGGGCTAAGAGAGGGAGGCCGGGGTGCGTATTTTACGTTACCCTCGACCACCTCTCTAAGGAAGGCCTCGCCCGCTTGTACGCAGTTGAAGAACTGCTGTACCTGCCGGGGGTGTCAGTTGAGGGATGGCGGCCAAGCCGTGGGCCGGCGCAGTGTCACCGCTGCCAGGCCTTCGGCCACGCCTCCACCAATTGCCACCGAGCGGTCCGCTGTGTGCGTTGTGCGGGTGAGCACATCGTGGCGGACTGCCCGAGGCCGAGGGAGGGGCCCTTCACCTGCGCCAACTGCGGAAAGGACCACGCAGCCGTTGACAAACGGTGCGTGGCCTACCGCAGGAGGGCGAGGATGTTGGGTGTTACCGTCCCCCCTCCCGTACCACCGGTGCCGCGCGCCCGGAGGCCTCCAGCTCCTGCAGTATCAGTACCAACACCATCTCAAGCAACTTCGACTCAAGTTCCGGCCGCTAGAGTCGTATCAAGTAAGGGCAAGGGCAAAGGGAAATCGTCCCAAGCCCCAATTCTCGCCCCAACTCCCACCTTACACTCACGGCAGCCCAACCTAGTGGAGTCGAATCCAGCAGCCTCCTCACTGATGGCACCGGCTAACGCTGCCCGACCGGCCGTTAGACCTCAACCGGCACCAAGAATTATTTCAAAAAAAAATAAAAAAAAGAAAGAGAAAGTCAAAGAGAGAAAGCGAGCGCAAAGACTAGCCGCCAATATCCCACCCACCCCAGTAGAGAGAATGACTCCAACTCCAATTTCTGTGCCAATGGAGGTCACAGAAGCAACGCCCCCCCTTACAACCAATACAACACCAACACCAATTGTAATCCACGCTCAGCCCCAAGAAAATTCGGTCGACGTGGGTATGACTCAGCCCCCACTACCACCCCGCCCGCAGAGGGAGCGGCGCAGCGGCAGACAGGACACGCAGCCTGCCGGCTTCGCTGCCTGGCTCCTCTCCCTGTGGGAGAAACTGTCCGAGGAGCTGCGCATCATCTACTGGAACCCCGACGGGATAGGGTCCCGGAGGTCGGAGCTCATCCGACTCGCCCAGGAGTATGACCCGCAGGTTATCCTCCTGGGCGAGACCAAGCTTAAACCTCGACAAGATTTTAGGATGCCCAACTACTTCGTGTACCGACGGGACGAACTGACCTCCAACGGGCGCCCGTTCAGGGGCACTGCGGCGCTCGTCAGGAGGGACGTGGTGCACGAGGAGCTTGAGCTACTGACCTTCGCCTCTACCAGAACGGTCGGGGTGAGGGTCCACGTACCGGGGGCCGAATTGCGGATTTATGCCGCGTATCGACCCCCGGGTCCTGATTTTGTCGAGGACGATATTAGACGGGCCTTGAACCATGATCGCCATCCGGCCTTGGTGGTCGGGGACCTCAATGCGAAACATGTCGCTTGGGGCTCCCGAATCATCACGCCGCCCGGAAGGCGATTGTACGAGGATGCCGAAAGGGGGGACTACTGCGTGGTCGGCCCCAACGAACCCACCCACGTTCCAACGTTGGCCCGGTACCAACCGGACGTGTTGGACGTGTGTGTTCATAAGGGGCTACGGTGCCCTCTAGCGATAGAGGCACTGTACGACCTGAGTACCCCTCACCTACCGATCTTGGTCACGGTGGGTTTGGGGCTCACTCGGGTCGCGACATCCCCTCTCAGGCCTAGGGTCGACTGGCAGTCCTTTACGGGACTGCTGGCCGACCAATCCTTGTTTCAAGACCCGTCTACCCCTGATGAGGTCGACACGGCGGCTTCCCGTCTCGTCGACACCATCAGGGGAGCCCTGGACCAAGTGACGACTCTGGTACCCAGCGGGGGGCCCAGAGCGGAACTCCCGGTGCACCTCAAGACGTTAATTCGTCGGAAGAGGGCACTGAGGAGGCTCTGGGCGACATCTAGGTGTCCCAGGATTAAGCGCGAGCTCAACCGACTTGAGGGGGAGCTGGCGACTAAGATGCGGACTTACCGGGGTGATTCCTGGGAGGGGGGACTGTTGGACGCGTCCGACGACCGTACGATGGCCCCCCTTCACCGCATCTGTCGCCGGCTCACCAACAAGCCTTCCCCCACTTGCCCCTTGGAGGACGAGGGGGGAAGACGGTGTTTTACACCGTTGGCTCGTGCCGAAGTCCTGGCCAACTCGCTGGAGCGGCAGTTCACTCCGAATGTCTCTGCACCCTCGATGGCTGCATTCCATCGCGAGGTGTCAGAGGGTGTAATCCAATTCCTCAAACCGGAATCGCCGGGAGTCGAGCTGGGAGATGACGACTTAGTCACTCCCAGCGAGGTGCGCCTCCTCATCAAGTTGATGAAGAGGCGCAAAGCCCCCGGCGAGGACGGTATTCCTCCCCTCGCCCTGCAAAACCTCCCTCCCTCAATCGTGTCAGCAATGACACGATTGTTCAATTCCATTCTCCGGGTAGGACACTTCCCTGGAACTTGGAAACTGGGCAAGATCATCGTCTTGCCCAAACCCGGCAAGGACAGGAGAAAGCCCTCCAGTTACCGACCGATTACCTTGCTCTCGCACGTGGGCAAGTTGTTCGAGCGGCTGCTCCTGAGGAGAATATCGCCGTATATTCTCCTCAGGCCGGAGCAATTCGGCTTTAGAAGCGGCCACTCGACGACTCTGCAACTGACCCGTGTCCTGCATCACTTGGCGGACCGGCGAAACTCGGGCCAATACACGGTCGCGGTCCTCCTCGATATCGAGAAGGCCTTCGACCGTGTGTGGCACGAGGGGCTGGTCCACAAGCTGCGGGACGCGGGCCTACCGCACGCTCACGTGCGACTGCTCGGGTCGTATCTGGAGGGCAGAACCTTCTTTGTCGCGGTCGAGGGCGCACGGTCTTCCGTGCGTCCCATTACGGCCGGGGTTCCCCAGGGTAGTGTCCTATCACCTATCCTATACGCCCTCTACACCAATGACATCCCCACCCTGGAGGGTCACCTTCGGGCGTGGGAGGAGGACGTGAAGTTGGCCTTGTTCGCTGACGACTCGGCCTACTTCTCGTCCTCCCCGTTCCCCTCTGCAGCCATCATGAGGATGCAGAGGCTTTTGGACATACTGCCCCAGTGGCTGGACCGTTGGAGAGTCGCGGTCAATGTGGGAAAGACCGCGGCCTTACTCTACGGTCCGGTCCGTATCAGAGTCGTCCCAAAGAAACTCAGCCTCCGAGGTGTGAATGTCGAGTTCAGGACCACGGTCCGGTATCTCGGATGCGACATCGACCGCTCTTTGAGCATGGTCGCGCACGTCAACCGAGTCATCGGTCAGGCTCGCGCGGCCATGTTCTTGTTGCGGCCGGTGTTTGCGTCCGGGCTTCCGACCAGGACCAAACTCGCCATTTACAAGACATACGTCCGTTCCCGCCTCACATACGCTGCTGCGGCCTGGTATCACCTGTTGTCGCCGTCCCAGCGATCTAGGTTGCAGGCCCAGCAGAGTCTTTCCCTCCGCATTATCGTCGGGGCCGGGCAGTACGTCAGAAATGACGTTATTGCCCGGGACCTAGGTGTGGAGTCGCTCGTGGAGTTTGTGACTAGGCTCGCCCGTAATATGTACGAGCGAGCCGAAAACGGGCCCCATGAGCATCTCCACAGCATAGCCCCGCTGCACGCCAGACCACCGGATGGTACGGCGTTGCCGCGGGAGCTATTGGTACCCCCGACGATCGTTCGGAGATAA
Protein
MIAGSGTMAAIAIRRDAAIPPLAMVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLGGIGAIARRLAPRPVILARDLNAKSVAWGSPRSDARGRLLERWVNAAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRICDWKVLEGAETLSDHRYIRSRTKEEPRRHPPIMVEVLPNWSRHMAAIRERLGRAPSVRPYGTGFRFLPASAEEYRVVQAYLAGASSADSAIKWYCYALEEDIPTRVAIRGLPADTDAAEITNSLKELGFPARYARCIRAKRGRPGCVFYVTLDHLSKEGLARLYAVEELLYLPGVSVEGWRPSRGPAQCHRCQAFGHASTNCHRAVRCVRCAGEHIVADCPRPREGPFTCANCGKDHAAVDKRCVAYRRRARMLGVTVPPPVPPVPRARRPPAPAVSVPTPSQATSTQVPAARVVSSKGKGKGKSSQAPILAPTPTLHSRQPNLVESNPAASSLMAPANAARPAVRPQPAPRIISKKNKKKKEKVKERKRAQRLAANIPPTPVERMTPTPISVPMEVTEATPPLTTNTTPTPIVIHAQPQENSVDVGMTQPPLPPRPQRERRSGRQDTQPAGFAAWLLSLWEKLSEELRIIYWNPDGIGSRRSELIRLAQEYDPQVILLGETKLKPRQDFRMPNYFVYRRDELTSNGRPFRGTAALVRRDVVHEELELLTFASTRTVGVRVHVPGAELRIYAAYRPPGPDFVEDDIRRALNHDRHPALVVGDLNAKHVAWGSRIITPPGRRLYEDAERGDYCVVGPNEPTHVPTLARYQPDVLDVCVHKGLRCPLAIEALYDLSTPHLPILVTVGLGLTRVATSPLRPRVDWQSFTGLLADQSLFQDPSTPDEVDTAASRLVDTIRGALDQVTTLVPSGGPRAELPVHLKTLIRRKRALRRLWATSRCPRIKRELNRLEGELATKMRTYRGDSWEGGLLDASDDRTMAPLHRICRRLTNKPSPTCPLEDEGGRRCFTPLARAEVLANSLERQFTPNVSAPSMAAFHREVSEGVIQFLKPESPGVELGDDDLVTPSEVRLLIKLMKRRKAPGEDGIPPLALQNLPPSIVSAMTRLFNSILRVGHFPGTWKLGKIIVLPKPGKDRRKPSSYRPITLLSHVGKLFERLLLRRISPYILLRPEQFGFRSGHSTTLQLTRVLHHLADRRNSGQYTVAVLLDIEKAFDRVWHEGLVHKLRDAGLPHAHVRLLGSYLEGRTFFVAVEGARSSVRPITAGVPQGSVLSPILYALYTNDIPTLEGHLRAWEEDVKLALFADDSAYFSSSPFPSAAIMRMQRLLDILPQWLDRWRVAVNVGKTAALLYGPVRIRVVPKKLSLRGVNVEFRTTVRYLGCDIDRSLSMVAHVNRVIGQARAAMFLLRPVFASGLPTRTKLAIYKTYVRSRLTYAAAAWYHLLSPSQRSRLQAQQSLSLRIIVGAGQYVRNDVIARDLGVESLVEFVTRLARNMYERAENGPHEHLHSIAPLHARPPDGTALPRELLVPPTIVRR

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=1.82751e-09,     Score=155

Ontologies

Topology

Length:
1513
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.12377
Exp number, first 60 AAs:
0.0878
Total prob of N-in:
0.00429
outside
1  -  1513
 
 

Population Genetic Test Statistics

Pi
251.612149
Theta
22.830008
Tajima's D
-1.867311
CLR
24.652673
CSRT
0.0233988300584971
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号