SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08089
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 3.301
 

Sequence

CDS
ATGCCGGAATGTCATACACCAACCCCAACACCTGCAATCCGTGTGGCCCCGATGGGACCCGGTGCGGGCAGTTCGTCCGGGCCTTCGGCCGCGGCCAGGGAATCCCTGAGGATCGTACCGGTGGAAAGTAACTTTCCTTCGTCGGCCGATCCCTCCGGGCCCTCTCGGCCGCGGAAGAAGGCCAGGTCAGAGTCTGACCGAGGCTCATCGGGTGACCAAGATAAACGCCCGCGTATAGGCCCTTCCTCCAGGTCGGAGGGAGAAGAGAGCGTGACCACGTCCACGGATCACTCCTCTACCGAGTCTATCACTCCTTCCTCGTCAAGATCCACTTCCCCCTCTGGGAGTCCAATCCCAGTCCAACCCGTTCCCAAGCCTAGAGCACCCGCCAGGACAGGGATTGCTCCTAGGCAATTGAGAACCCCTCCTCACTCCCCTTCCCCAACTTTATCCCCAATCCCGGTGGACTCTACCCGAGGTGCCCCCGCCCTAAGCGGCACGGCGGGTAACCTGGACTCCACCAGGTACATGGACCTCGAGTCCACCAGACCACGTCACGCCCCTATGCCTAACCCCATTCCCTCTACCTCCTATGCTGCCATGGCAGCTAGGCCGAGTATTCCTTCCACCCAGAGGACATCCCAATCCTCTCATGTCCCTCCCCCGAGGCCGAAGGGTCGTGCCCAAGAGGGGCTGCGCCGACATCCGCCAATAATGGTGGAGGCCCTTCCTAATTGGTCCCGCCACATGGCGGCCATTAGGGAGCGCCTCGGTCGCGCCCCCTCGGTGCGACCCTTCGGCGCCGGCTTTAGATTCCTGCCGACGTCGGTAGAGGAATACAGGGCGGTCCAGGCCTACCTGTCGGAGGCCTCTGCCAGGGATGGTACCATAAAATGGTACTGCTATGCCCTGACAGGGGAGATTCCGACTAAGGTGGCTGTCCGGGGCCTCCCTGCCGATACTGACGCGGCAGAAGTAACCGATGCCCTGAAGGAGCTGGGGTTTCCGGCTCGTCACGCCAGGTGCATCAGGTCCCAGAGAGGGCGCCCGGGCTGCGTGTTCCACGTAGCCTTGGACCACCTCTCGAAGGACGACCTCGCCCGCCTGTACGCAGTCAATGAACTGCTGTACTTGCCGGGGGTGACGATTGAGGGATGGCGACCAACCCGCGGGCCTGCGCAGTGTCATCGCTGCCAGGCCTTCGGGCACGCCTCCAATAATTGTCACCGAGCGGTCCGCTGCGTTCGATGTGCCGGGGAGCATGTCGTAGCGGACTGCCCGAGGCCGAGGGACGGCCCATTCTCCTGCGCCAATTGCGGGAAAGATCACGCTGCCGTCGACAGGCGGTGCGCGGTCTACCGCAAGAGGGCCAGGATGATGGGAGTAACCGTCCCTCCTCCTGCGCCGTTGGTGCCTCGATCCGGGAACACAGCTCCTCCTCCTTCTGTAGCTCCCATTCCGAAGGGGAAGGGGAAAGGGAAAGGGAAATCTTCCCAACCCCAACCCCCTCCCCCGTCCTCACCCATCCCCCCTGCCGTGTCAGTGGAGGCCAATCCATCAGCGGCAACGCTGATGGCAGAGGCCAACGCTCCGCGGCGGGGTATACCTGTTCCTACCCCTCGTGGTTCACACGCTGTTAGATTGCCCCATCCTAATAGCAGTGTTCCAGCTCGTGCTGGAACTCAAGTCCCACAATTATCAGGTCCGAAACAAAAAAAAAACCGACTAAAAAAAATAAAAAAAAAATTAAGGAAGAGAGCCCAACGGGATGCAGTGGTGAGTGCTCCTACTGCACCGGCTCCCGCGGCTCCTTTAACAATGGAGGTGGACGTGAACCCACCCATCGACCCAACTTCTCAACCGACTTCACAATCGGGAACGACCCCACTGCCCCAGGCCCAACCAGCCATCTCGGGCACATCTCAGCCCCCCCTCCCCCCCCGCCCTCAGCGCGAGCGCCGCAGCGGTCGACAGGCCTCCCAGCCTGCCGGCTTTGCTGCATGGCTGCTCGCACTGTGGGAGAAATTGTCCGAGGAGCTGCGCATCATTTATTGGAACCCCGACGGGATAAAGTCCCGAAAGAACGACCTGCTTGTTCTCGCCCGGGAGTATAACCCAGAGGTTGTGCTCCTGGGCGAGACCAAGCTACGTCCTCAGGATGCGTTCAGGATTCCAAACTACTTCATGTACCGACGTGACGAGCTTACCCCTGCCGGGCGGCCGTTCAGGGGCACTGCGGCCCTCGTCAGGCGGGACGTGGTGCATGATCAGTTGGATTTGCTGTCCTTCACATCGACAAGGTCAGTCGGTGTGAGGGTACACACCTCGGGGGGAGATATGCGGATTTATGCCGCGTATAGACCCCCGGGGCCTGAATTTCACCCTGAGGACATAAGACGGGCCCTGAATCACGACAGCCGCCCAGCTCTGCTGGTCGGGGACCTCAACGCGAAGCACGTCGCGTGGGGCTCCCGACTTAACTCAGCAGTGGGCAGGCGGCTGTTAGAAGATGCCGATAGGGGCGACTACTCCGTGGTCGGCCCCGACGAACCCACACACATCCCGACCGCCGCGCGCTATCAGCCCGATGTGCTGGACGTGTGTGTGCACAAGGGGCTACGGTGCCCCGTAACGATCGAGGCACTGTACGACCTGGGTACCCCACATCTCCCTATCCTGGTGACACTGGGAATGGGGCTCACCCGGGTTGCGACCTCGCCCCTACGACCGAAGGTCGACTGGGAGCTCTTTAAGAGACGACTAGTCGACCTTCCCGTGATTCAGGACCCCAACACCCCTGATGGGGTCGACGATGCGGCAACCCGCCTTGTTGACTCCATCAGGGGAGCGATCGACCAGGCGACGACTCTTGTGCCCAGCGGCGGGCCCAGAGGTATACTCCCGGCCCATCTGAAGGCGATTATTCGCCGGAAGAGGGGCTTGAGGAGGCTCTGGGCGACAACTCGTTGTCCCAGGATAAAGCGCGAGCTTAATGAACTGGAAGCGGAGCTGGCGACAAAGATTAGCACCTTTCGGGGCTATGCCTGGCAGGAGAGGATCGAGGAGGCCCGCGAGGACCCCTCCTCAGTATCCCTCCACCGGCTTTGTCGCCAGCTCTCAAATCGGCCTGCCCCGACTTGTCCACTCGTGGACGAGAGGGGCAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATGTCCTGGCCGAAATGCTGGAGCGGCAGTTCGCTCCTAATGACTCTGCACCCTCAGAGGCCGCATTCCACCAATCGGTGGAAGAGAGCGTAGCAAGCCTACTCTCCTCCCCGGTGCCACCGTTGGGAGATGGTGATCTCATCACTCCCAGCGAATTGCGCCTCATCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGCGAGGACGGTATTCCCTCCCTCGCTTTTTTCCACTTCCCTGAAACGGTCATGTCATATATGACACGGCTGTTCAACTCCATTCTGTCCACAGGACACTTCCCGGGAATTTGGAAATTGGGCAAGGTTATCGCCTTGCCCAAACCCGGCAAGGACAGGAGAAATCCCTCCAGTTACCGTCCGATCACGCTGCTGTCGCACGTGGGCAAGTTGTTCGAGCGGCTGCTGCTGAGAAGGATGTCGCCGCACATCCTTCTCAGACCCGAGCAATTCGGGTTTCGTAGCGGTCACTCGACAACGCTGCAATTGGTCCGCGTCATGCATCACTTGGCGGATCGGACCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGACATCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGATCCACAAGCTGTTGCAGAACACGGACCTCCAGCACGCCTACGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCCTTGTCGCGGTCGAGGGCGCCAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCGCAGGGGAGCGTCCTGGCACCATTCCTCTACGCTCTCTACACCAACGACATTCCCACGCTCGAGGGCAACCTCGAAGCGTGGGAAGCCGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCGCGTCATCCAACTTCCCCTCTGCGGCCATTTCGAGGATGCAGAGGTTATTGGACTTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACCGCGGCTATTCTCTTCGGTCCGGTCCGCACAAGAGTCGTCCCGGGACAGCTCAGTCTCCGTGGCGCTAATGTCGAGTTTAGATCCAGCGTCCGGTACTTGGGGGTCGATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAAATTGGCGTTGGCGGCCGCTCGCTACGCGAGATTCCTCCTCCGGCCGGTGTTGGCCTCCAGGTTGCCGGTCAGGACTAAGCTCGGCATTTATAAGACGTATGTCCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGGCCATGCGGGTGAAGTTACAGGCCCAGCAGAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGTAATGCCGTAATCGCCCGGGATCTGGATGTGGAGTCGCTCGAGGAGTTCATCCGGAGGCTAGCTCGTAATCTTTACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATTTAGCTCCCTTGCACGCTAGACCACCTGATGGTCTGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGGAATCAAAAAGTGAAATCGTTTTACTTGGTGTTCAACAAGATAATGTCTACCCTCAAGCCTACATCAGAAGTGAGATCAGGACTCTACTCTCACTGGCGTGA
Protein
MPECHTPTPTPAIRVAPMGPGAGSSSGPSAAARESLRIVPVESNFPSSADPSGPSRPRKKARSESDRGSSGDQDKRPRIGPSSRSEGEESVTTSTDHSSTESITPSSSRSTSPSGSPIPVQPVPKPRAPARTGIAPRQLRTPPHSPSPTLSPIPVDSTRGAPALSGTAGNLDSTRYMDLESTRPRHAPMPNPIPSTSYAAMAARPSIPSTQRTSQSSHVPPPRPKGRAQEGLRRHPPIMVEALPNWSRHMAAIRERLGRAPSVRPFGAGFRFLPTSVEEYRAVQAYLSEASARDGTIKWYCYALTGEIPTKVAVRGLPADTDAAEVTDALKELGFPARHARCIRSQRGRPGCVFHVALDHLSKDDLARLYAVNELLYLPGVTIEGWRPTRGPAQCHRCQAFGHASNNCHRAVRCVRCAGEHVVADCPRPRDGPFSCANCGKDHAAVDRRCAVYRKRARMMGVTVPPPAPLVPRSGNTAPPPSVAPIPKGKGKGKGKSSQPQPPPPSSPIPPAVSVEANPSAATLMAEANAPRRGIPVPTPRGSHAVRLPHPNSSVPARAGTQVPQLSGPKQKKNRLKKIKKKLRKRAQRDAVVSAPTAPAPAAPLTMEVDVNPPIDPTSQPTSQSGTTPLPQAQPAISGTSQPPLPPRPQRERRSGRQASQPAGFAAWLLALWEKLSEELRIIYWNPDGIKSRKNDLLVLAREYNPEVVLLGETKLRPQDAFRIPNYFMYRRDELTPAGRPFRGTAALVRRDVVHDQLDLLSFTSTRSVGVRVHTSGGDMRIYAAYRPPGPEFHPEDIRRALNHDSRPALLVGDLNAKHVAWGSRLNSAVGRRLLEDADRGDYSVVGPDEPTHIPTAARYQPDVLDVCVHKGLRCPVTIEALYDLGTPHLPILVTLGMGLTRVATSPLRPKVDWELFKRRLVDLPVIQDPNTPDGVDDAATRLVDSIRGAIDQATTLVPSGGPRGILPAHLKAIIRRKRGLRRLWATTRCPRIKRELNELEAELATKISTFRGYAWQERIEEAREDPSSVSLHRLCRQLSNRPAPTCPLVDERGNRCFSAQARADVLAEMLERQFAPNDSAPSEAAFHQSVEESVASLLSSPVPPLGDGDLITPSELRLIIKRMKRRKAPGEDGIPSLAFFHFPETVMSYMTRLFNSILSTGHFPGIWKLGKVIALPKPGKDRRNPSSYRPITLLSHVGKLFERLLLRRMSPHILLRPEQFGFRSGHSTTLQLVRVMHHLADRTNARQYTAAVFLDIEKAFDRVWHAGLIHKLLQNTDLQHAYVRLLGSYLEGRSFLVAVEGAKSSVRPVTAGVPQGSVLAPFLYALYTNDIPTLEGNLEAWEADVKLALFADDSAYFASSNFPSAAISRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTRVVPGQLSLRGANVEFRSSVRYLGVDIDRSLRMTAHAKLALAAARYARFLLRPVLASRLPVRTKLGIYKTYVRSRITYAAAAWYHLIPQAMRVKLQAQQNLALRTIVGAGRYVSNAVIARDLDVESLEEFIRRLARNLYERADGGPHEHLHNLAPLHARPPDGLALPRELLEPPAMESKSEIVLLGVQQDNVYPQAYIRSEIRTLLSLA

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=6.20211e-05,     Score=116

Ontologies

Topology

Length:
1613
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01503
Exp number, first 60 AAs:
0.00119
Total prob of N-in:
0.00007
outside
1  -  1613
 
 

Population Genetic Test Statistics

Pi
1.334285
Theta
11.895654
Tajima's D
-0.819433
CLR
77.830134
CSRT
0.172791360431978
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号