SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07729
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
RNA-directed DNA polymerase from mobile element jockey       + More
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.736
 

Sequence

CDS
ATGATACTCGTGGCGTTAGAACCCACCCCGGAGGCCAAAAAGAAGATCGCATGTCTCACGACAATTTGCGGCCTATCCGGGATCTCAATCGAAGCCCCCCACAAGCGTGGCACTCCCGGGCAGTGCTACAGATGTCAGCTTTACGGCCACTCGGCTCGCAATTGCCACGCGCGCCCCCGCTGCGTAAAGTGCCTCGGCGACCACGCCACACTAGATTGCTCGCGTGTTAGGGAAACCGCGACCGAACCCCCAAGCTGTGTCCTATGCCTTAAGCAAGGGCACCCCGCGAACTACCGTGGATGTCCTAGGGCTCCGCGCAAGCGTTCAACCCTCCCAGCTCCGCGAACCGTCGGCCCAAAGACTTCGGCACCCTCAGTGCCGAAACCTGCCTTCGTGCCGGCTGCAGTTCCCACGGTTTCAGCGTGGAAAAAGCCGCTGCCGTATACGAAGGCGGGAACACAAACCGCACCCCCGCCCCCGCTCGCGACACGCCCCGCGCCTCAGCCCCTGCTCGCACCTCGCCCCGCGCCCGCGTTCCGTCCCCCGCAACCCTCTGCCGCCAACGACTTCGCGCTCGTGCGCGACTTCGTCACCGCGGTGAACTTCGACCGTCTGCGATCGTTCGCTGACGCTATCCGTAGGTCGACAACCCCCGAACAGCGGCTCGCGGCCGCGTTCGATCACATGGACGTTTACGAGTCCGTGTCGCCATTCTATAATGCTAACGGACTCGCGCGGCAACGCGATCAAATTTTTGAATTCCTCCGCGATAATCTTGTAGATATTCTATTAGTGCAGGAAACCTGTCTGAAGCCCTCGCGTCGCGACCCGAAAGTCGCGAACTACGTCATGGTTAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTATAGGCGGGCCCTGCACGTTGTCCCTCTCGATACTCCCTCGCTCTCACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTTCTGAGCAGTGACATCGAGTCACTGTTCGGCATGGGAGACTCCGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGTACAAACGTTAACGGTAGGCGTCTCGACGCGTTTATAGACGACCTCACCTTTGAAATAGTCGGCCCCCCAACTCCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCATTGCTTAGGAACGTAACTCTGCGCTTGCGTTCCATCGAAGCAATGTCAGAGCTCGACTCAGACCACCGACCTGTCGTTATGCAGCTCGGTCGCCCTCACAACCCAGTCACTGTTACGAGGACCATGGTGGATTGGAATAAGCTGGGCACGTGCCTAGCCGACGCCGCTCCGTCAATCCTCCCTTACGGCCCGGATTCGAATCCATCCCCCGAGGACACCGTCGAATCCATAAACATCATTACCGATCACATCTCTTCCGCGATCATTAGATCTTCTAAAGAAGTCGATATGGAGGACAGCTTCCACCGCATCAGACTGTCCCCCGATCTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTTCCCACGCATTCAAACCGGATTCAGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCTTAAGCGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCTTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAAGACGCGATCCACAACCTCCAACCTAGGAAGGCACCAGGCTCCGACGGCATCCACAACCGCGCGCTAAAATTTTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTCCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGTATACATAAGCCGGGCAAACCGAGAAACGAAACTTCTAGTTACCGTCCGATTAGTCTCCTCTCGACGATAGGAAAAATTTACGAACGTCTCCTTAGAAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCAAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATTCTGATAGGGCTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTACAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACCGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCATGGGACAGTGGTTCCGGAAGTGGCGAATAGACATTAACCCCACGAAAAGCGCAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACATCACTTCGAGCATCCCACTCCGTAGTAGGCGCGCAAACACCTCCGCCGTTAGTCCCATCACTCTCTTTGGCCAGCCCATTCCGTGGGTCTCGAAGGTCAAATATCTAGGCGTCACTCTCGACAGAGGGATGACATTCCGTCCCCATATAAAAACGGTACGCGACCGCGCCGCGTTTATTCTAGGACGACTCTATCCAATGCTTTGTAGTCGAAGCAAACTGTCCCTCCGCAATAAGGTAACTCTCTACAAAACTTGCATACGCCCCGTCATGACGTATGCAAGCGTAGTGTTCGCTCACGCAGCCCGCACCCACTTGAAATCCCTTCAGGTTATTCAATCACGATTCTGCAGGATAGCCGTCGGAGCGCCTTGGTTCCTTAGGAATGTGGATCTCCACGACGACCTGGAGCTCGACTCTCTTAGTAAGTATCTACAGTCGGCATCGCTGCGCCATTTTGAGAAGGCGGCACGACATGAGAACCCTCTCATCGTAGCCGCTGGAAATTACATACCCGACCCAGTAGACCGAATGGTAAACCGTCGACGTCGCCCAAAGCACGTCATTACGGATCCTCCTGATCCATTAACGGTGCTTTTAGGCACCACAAGCACCGGTCACCGTCCTCGTCGAACCCGTCGCTTGCGACGAAGGGCTCGACGAGCGAACTAA
Protein
MILVALEPTPEAKKKIACLTTICGLSGISIEAPHKRGTPGQCYRCQLYGHSARNCHARPRCVKCLGDHATLDCSRVRETATEPPSCVLCLKQGHPANYRGCPRAPRKRSTLPAPRTVGPKTSAPSVPKPAFVPAAVPTVSAWKKPLPYTKAGTQTAPPPPLATRPAPQPLLAPRPAPAFRPPQPSAANDFALVRDFVTAVNFDRLRSFADAIRRSTTPEQRLAAAFDHMDVYESVSPFYNANGLARQRDQIFEFLRDNLVDILLVQETCLKPSRRDPKVANYVMVRNDRLTASKGGTAIYYRRALHVVPLDTPSLSHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIVGPPTPTCYPYNIALRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPHNPVTVTRTMVDWNKLGTCLADAAPSILPYGPDSNPSPEDTVESINIITDHISSAIIRSSKEVDMEDSFHRIRLSPDLRNLLRVRNAAIRAYDRLPTHSNRIQMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLLRPSGQPPAFDDDDKAELLADALQEQCTTSTQHADPEHTEDAIHNLQPRKAPGSDGIHNRALKFLPVQLIAMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPRNETSSYRPISLLSTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATMGQWFRKWRIDINPTKSAAVLFKRGRPPNITSSIPLRSRRANTSAVSPITLFGQPIPWVSKVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCSRSKLSLRNKVTLYKTCIRPVMTYASVVFAHAARTHLKSLQVIQSRFCRIAVGAPWFLRNVDLHDDLELDSLSKYLQSASLRHFEKAARHENPLIVAAGNYIPDPVDRMVNRRRRPKHVITDPPDPLTVLLGTTSTGHRPRRTRRLRRRARRAN

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
AB018558    BAA76304.1    U07847    AAA17752.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    KQ971729    KYB24751.1    GALX01005359    JAB63107.1    GALX01005299    JAB63167.1    GBBI01004395    JAC14317.1    GGMR01018716    MBY31335.1    GBBI01004571    JAC14141.1    ABLF02042518    ABLF02057746    S59870    AAB26437.2    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GGFJ01001842    MBW50983.1    RPOV01000134    RPJ78669.1    GGFJ01001844    MBW50985.1    GGFJ01001843    MBW50984.1    GGMS01002992    MBY72195.1    KK119692    KFM76444.1    ABLF02023911    NEVH01011985    PNF31054.1    NEVH01017470    PNF24199.1    GGFJ01001858    MBW50999.1    NEVH01009134    PNF33528.1    GGFJ01001857    MBW50998.1    NEVH01027074    PNF13841.1    GGFL01004957    MBW69135.1    NEVH01021205    PNF19912.1    GGFL01005012    MBW69190.1    ABLF02034467    GGMS01006359    MBY75562.1    GFTR01008038    JAW08388.1    GFTR01008279    JAW08147.1    NEVH01006736    PNF36716.1    M95171    AAA29354.1    GGMR01000676    MBY13295.1    GBGD01000415    JAC88474.1    GGFJ01001822    MBW50963.1    GFTR01008262    JAW08164.1    GFTR01008261    JAW08165.1    GFTR01008271    JAW08155.1    GFXV01000908    MBW12713.1    GFTR01008151    JAW08275.1    GGMR01003407    MBY16026.1    GFDL01000006    JAV35039.1    GFTR01008269    JAW08157.1    NEVH01016302    PNF25823.1    AY180919    AAN87272.1    GFTR01008251    JAW08175.1    GGFK01007981    MBW41302.1    GFTR01008256    JAW08170.1    NEVH01026386    PNF14434.1    X17551    CAA35587.1    AY508487    AAS13459.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GEDC01000337    JAS36961.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    M22874    M38643    KU543673    AMS38352.1    GBGD01000389    JAC88500.1    GGFL01005121    MBW69299.1    NWSH01007753    PCG62823.1    GEHC01000968    JAV46677.1    GGMS01017365    MBY86568.1    GGFL01005122    MBW69300.1    NEVH01020940    PNF20481.1    AY047531    AAK77263.1    GEZM01084969    JAV60363.1    ABLF02040174    ABLF02040183    ABLF02055266    GFTR01008260    JAW08166.1    NEVH01022639    PNF18527.1    GGMR01006408    MBY19027.1    GGMR01016905    MBY29524.1    AY060438    AAL25477.1    AF456125    AAL57609.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.000950367,     Score=105

Ontologies

Topology

Length:
1155
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.55824
Exp number, first 60 AAs:
0.00368
Total prob of N-in:
0.00023
outside
1  -  1155
 
 

Population Genetic Test Statistics

Pi
107.608126
Theta
20.556764
Tajima's D
2.105697
CLR
0.143427
CSRT
0.903754812259387
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号