SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07697
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Full name
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 2.017 Nuclear   Reliability : 1.726
 

Sequence

CDS
ATGTACTTGCCGGGGGTGACGGTTGAGGGATGGCGTCCAAACCGAGGACCTGCGCAGTGTCACCGCTGCCAGGCCTTCGGTCACGCGTCCACCAATTGTCACCGTGCGGTCCGCTGCGTTCGATGTGCCGGCGAGCACATTGTGGCGGACTGCCCGAGGCCAAGGGATGGCCCATTATCCTGTGCAAATTGCGGGAAGGACCACGCCGCCATCGATCGGCGTACCATTCCGTCTGTCTCGGTAGTGGAGGCAGCGCCGTCAGCGACCACGCTGATGGCGCAGGCCAACCCGCCGCGACAGACCAAAACGTCCAACCCCACTCCTCGTGGCCGAGCCCAAATTATAGCTGTCACCACAGCCCACGACACTCGCCAGACAGCCGGCTCAGCCCCTAAATCTACAAAAAATAAAATTAAAAATAAAAAAAAGAAGGAGAGGAAGAAACTCTTGAAGAAAATGGCGAGAGAGAGCAGCGCCAGAAACATGGAAGTGGACCAACAACTTCATGAGGCCATGGAAGCCAACGTAACTGCCGACCCTAACCCTCCACAACTGGAGGGACAAACATTGCCTCAAGCTCAATCTGAGCCGTTGGGCAATACTCTGCCCCCTCTTCCCCCCCGCCCTCAGCGCGAGCAGCGCAGCGGTCGGCAGGCCTCACAGCCTGCCGGCTTTGCTGCATGGCTTCTCGCGCTCTGGGAAAAATTGTCCGAGGTGGTCTCCGGAGTGATCCGCGAGATCGCCTCGGGAGCCAGCCCTTTCGGGGCTCTCTTGTCGGGGGTTGTACTCCCGGGCGAGACCAAGCTACGTCCTCGGGATGTGTTCAGGATTCCAAACTACTTCATGTACCGACGTGACGAGGTGAGTCCTGCCGGGACGCCGTTCAGAGGCACTGCGGCGCTCGTCAGGCGAGACGTGGTGCATGATCAGTTGGATTTGCTGGCCTTCACATCGACAAGGTCGATCGGTGTGAGGATCCACACCTCGGGGGGAGATATGCGGGTTTATGCCGCGTATAGACCCCCGGGGCCTGATTTTCACCCCGGGGACATAAGACGGGTCCTGAATTGCGACAGCCGCCCAGCTCTGCTGGTCGGGGACCTCAACGCGAAGCACGTCGCGTGGGGCTTCCGACTGAACTCAGCGGTGGGCAGGCGGCTGTTAGAAGATGCCGATATGGACGACTACTCTGTGGTCGGCCCCGACGAACCCACGCACATTCCGACCGCCGCGCAACTCCAGCCCGACGTGTTGGATGTGTGCGTTCATAAGGGGCTACGGTGCCCCTTAACTATTGAGGCACTGTACGACCTGGGTACCCCCCATCTCCCTATCCTGGTCACACTGGGAATGGGGCTTACCCGGGTTGCGACCTCGCCCCTACGACCGAGGGTCGACTGGGAGCTCTTTAAGAGACGCCTAGTCGACCTTCCCGTAATTCAGGACCCCAACACCCCTGAGGGTGTCGACGACGCGGCAGTCCGCCTTGTCGACTCCATCAGGGGAGCGATCGACCAGGTGACGACTCTTGTGCCCAGCGGCGGGCCCAAAGGTATACTCCCGGCCCATCTGAAAGCGATTATTCGCCGGAAGAGGGGCCTGAGGAGGCTCTGGGCGACAACTCGTTGTCCCAGGATCAAGCGCGAGCTTAATGAGCTGGAAGCGGAGTTGGAGGCGAAGATTAGCTCCTATCGGGGCTATGCGTGGGAGGAACGGATCGAGGAGGCCCGTGAGGACCCCTCGTCCGTGTCCCTCCACCGACTTTGTCGCCAGCTCTCAAATCGGCCTGCCCCGACTTGTCCACTCGTGGACGAGAGGGGCAACCGACGCTTCTCGGCTCAGGCCCGCGCCGATATCCTGGCCGTAATGCTGGAGCGGCAGTTCGCTCCAAATAACTCTGCACCCTCAGAGGCCGCATTCCACCAATCGGTGGAAGAGAGCGTAGCAAGCCTACTCTCCTCCCCGGTGCCACCGTTGGGAGATGGTGATTTCATCACTCCCAGTGAATTGCGCCTCTCCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGCGAGGACGGTATTCCCTCCCTCGCATTTTTCCACTTCCCCGAAACGGTCGTGTCATTCATGACACGACTGTTCAATTCCATTCTGTCCACAGGACACTTCCCGGGAATTTGGAAATTGGGCAAGGTTATTGCCCTGCCCAAACCCGGCAAGGATAGGAGAAATCCCTCCAGTTATCGTCCGATCACTCTGCTGTCGCATATGGGCAAGTTGTTCGAGCGGCTGCTGCTGAGAAGGGTGTCGCCGCACATCCTTCTCAGACCCGAGCAATTCGGGTTTCGCAGCGGTCACTCGACAACGCTGCAATTGGTCCGCGTTATGCACCACTTGGCGGATCGGTCCAACGCGCGCCGGTACACGGCCGCAGTCTTTCTCGATATCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGATCTACAAGCTGTTGCAGAACACGGACCTCCAGCACGCCTATGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCCTTGTCGCGGTCGAGGGCGCAAAGTCGTCGACCAACGACATTCCCACGCTTGAGGGCAACCTCCAAGCGTGGGAAGCCGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCGCGTCCTCAAATTTCCCTTCTGCGGCCATTACGAGGATGCAGAGGCTGTTGGACTTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACCGCGGCTATTCTCTTCGGTCCGGTCCGCACAAGAGTCGTCCCAGGACAGCTCAGTCTTCGTGGAGTCAATGTCGAGTTTAGGCCCAGTGTCCGATACCTGGGAGTCAGTATCGACCGGAGTTTGAGGATGACCGCCCACGCCAAGTCGGCGTTGGCGGCCGCCCGCTATGCGAGGTTTCTCCTCCGGCCGGTGTTGGCCTCCAGGTTGCCGACCAGGACTAGACTCGGCATTTACAAGACGTATGTTCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGATCATGCGGGTGAAGTTACAGGCCCAGCAGAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGAAACGACGTAATCGCCCGGGATCTAGATGTGGAGTCGCTCGAGGAGTTCATTCGGAGGCTAGCTCGTAATATGTACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTCGGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGGTAAGATAG
Protein
MYLPGVTVEGWRPNRGPAQCHRCQAFGHASTNCHRAVRCVRCAGEHIVADCPRPRDGPLSCANCGKDHAAIDRRTIPSVSVVEAAPSATTLMAQANPPRQTKTSNPTPRGRAQIIAVTTAHDTRQTAGSAPKSTKNKIKNKKKKERKKLLKKMARESSARNMEVDQQLHEAMEANVTADPNPPQLEGQTLPQAQSEPLGNTLPPLPPRPQREQRSGRQASQPAGFAAWLLALWEKLSEVVSGVIREIASGASPFGALLSGVVLPGETKLRPRDVFRIPNYFMYRRDEVSPAGTPFRGTAALVRRDVVHDQLDLLAFTSTRSIGVRIHTSGGDMRVYAAYRPPGPDFHPGDIRRVLNCDSRPALLVGDLNAKHVAWGFRLNSAVGRRLLEDADMDDYSVVGPDEPTHIPTAAQLQPDVLDVCVHKGLRCPLTIEALYDLGTPHLPILVTLGMGLTRVATSPLRPRVDWELFKRRLVDLPVIQDPNTPEGVDDAAVRLVDSIRGAIDQVTTLVPSGGPKGILPAHLKAIIRRKRGLRRLWATTRCPRIKRELNELEAELEAKISSYRGYAWEERIEEAREDPSSVSLHRLCRQLSNRPAPTCPLVDERGNRRFSAQARADILAVMLERQFAPNNSAPSEAAFHQSVEESVASLLSSPVPPLGDGDFITPSELRLSIKRMKRRKAPGEDGIPSLAFFHFPETVVSFMTRLFNSILSTGHFPGIWKLGKVIALPKPGKDRRNPSSYRPITLLSHMGKLFERLLLRRVSPHILLRPEQFGFRSGHSTTLQLVRVMHHLADRSNARRYTAAVFLDIEKAFDRVWHAGLIYKLLQNTDLQHAYVRLLGSYLEGRSFLVAVEGAKSSTNDIPTLEGNLQAWEADVKLALFADDSAYFASSNFPSAAITRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTRVVPGQLSLRGVNVEFRPSVRYLGVSIDRSLRMTAHAKSALAAARYARFLLRPVLASRLPTRTRLGIYKTYVRSRITYAAAAWYHLIPQIMRVKLQAQQNLALRTIVGAGRYVRNDVIARDLDVESLEEFIRRLARNMYERADGGPHEHLHNIAPLHARPPDGRALPRELLEPPAMVR

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
RSAL01000708    RVE41206.1    NWSH01000895    PCG73652.1    ABLF02034467    ABLF02008153    + More
ABLF02008462    ABLF02008464    ABLF02023911    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GEZM01008457    JAV94772.1    ABLF02042518    ABLF02057746    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    NEVH01017470    PNF24199.1    NEVH01011985    PNF31054.1    ABLF02041767    NEVH01021205    PNF19912.1    GFTR01008279    JAW08147.1    GALX01005299    JAB63167.1    GBBI01004395    JAC14317.1    GFTR01008262    JAW08164.1    NEVH01026386    PNF14434.1    NEVH01008277    PNF34262.1    NEVH01007402    PNF35856.1    NEVH01016340    PNF25410.1    NEVH01015305    PNF27092.1    GALX01005359    JAB63107.1    NEVH01021925    PNF19341.1    NEVH01023979    PNF17579.1    NEVH01001347    PNF42959.1    GGMR01003407    MBY16026.1    NEVH01006736    PNF36716.1    GBBI01004571    JAC14141.1    GGMS01002992    MBY72195.1    GFXV01000908    MBW12713.1    GBGD01000415    JAC88474.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    KQ973342    KXZ75569.1    NWSH01000032    PCG80496.1    GBBI01003810    JAC14902.1    NEVH01016302    PNF25823.1    GGFL01004957    MBW69135.1    GFTR01008246    JAW08180.1    AB055391    BAB21761.1    AB018558    BAA76304.1    GFTR01008254    JAW08172.1    GGMS01017365    MBY86568.1    GGMR01003864    MBY16483.1    GEZM01084969    JAV60363.1    KQ459265    KPJ02064.1    GEZM01053022    JAV74219.1    GFTR01008038    JAW08388.1    GBGD01000389    JAC88500.1    ABLF02041861    GGMR01018716    MBY31335.1    GBBI01003747    JAC14965.1    GGMR01012283    MBY24902.1    AF081103    AAC72921.1    KK119692    KFM76444.1    KU543687    AMS38379.1    GFTR01008269    JAW08157.1    NWSH01007753    PCG62823.1    GGMR01012443    MBY25062.1    U07847    AAA17752.1    GGMR01000676    MBY13295.1    NEVH01005295    PNF38784.1    M22874    M38643    GFXV01002840    MBW14645.1    GGMR01020516    MBY33135.1    GGFJ01001822    MBW50963.1    GGMR01000226    MBY12845.1    GEHC01000978    JAV46667.1    NEVH01022639    PNF18527.1    GFDL01000004    JAV35041.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
1113
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02981
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00007
outside
1  -  1113
 
 

Population Genetic Test Statistics

Pi
237.916514
Theta
202.145546
Tajima's D
0.451916
CLR
139.158996
CSRT
0.500474976251187
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号