SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07596
Pre Gene Modal
BGIBMGA000234
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 3.467
 

Sequence

CDS
ATGCCAGGGGGGATCTCACCCCCCATTCACAGCACACCCACAACCTCGCGAAGGGACAAACCGAGCACAGTAGAGGATCCGCAAGATTATGGATCGCATATGCCACCTGCACCCAGCGCTGCTCGCGCCGCCCCTGGTCTGATCGAAAGGCCTGGCACGCCTTGGGGGGGCCAGGATTCTCCGAGGGTCGGTCCGGGGCAAACTATGTTTCCCCTACCGGCCGACTGTCCGGAGACGCCTCGACCCCGCAAGAAGGCTAGGTCCGAATCGGACAAGGGCTCGGCGGAAGCAGTGGACAAAAGACCTAGACTGGGTAGATCCGTCGACTCATCGGACGACTCTGGTAGCTCCCAGTCAGTTAGCTCATCTCGCGGCTCCGCCTCCGCTGACTCCAACAGCTCCACAAAGACCGGGCCCAGACCAAGACCACAACCAAAGCCATTACATGAGGCTCCGAAGCCAGCCAGTAGGAGGGAAAGAACTCCTCCTCGATCTCCATCCCCTACTAATACACTGGACCCTATGACTATCAATAAGGGTGCTCCTGCCCGAGACAACAACATCAACATCACAGGCCCGAAACAGTCCACTTCTTATGCTACAATAACAGCTCAAGTCCCTCCTCCTAAACAAATTACACCCTCCAAACTTACAACAATCCCCCAAAAAGAAGGCGACAGGGAAAAACTTAAACACCATCCACCCATCATGGTCGAGGCTCTCCCTAACTGGACACGACATATTGCAGCAATCAGAGAGCGCCTCGGCAGAGTCCCATCAGTCCGACCACTAGGGAGAGGGTTCCGCTTCCTGCCAGCGTCGGTGAACGAGTACAGGGTGGTCCAGGCCTACCTCTCGGAGGCCTCCTCGGCGGATAGCGGCATCAAATGGTACTGCTATGCGCTAGCCGAGGAGATCCCATCGAGGGTGGCCATCAAAGGACTCCCCCCCGACACCGATGCGGCATTAGTAGTGGAGGCCCTAAAGGAGAAGGGATTCCCGGCCAGGTATGCCAGGTGCATCTTGGCTAAGAGAGGAAGACCAAGTTGTGTGTTCTTTGTCACACTGGACCATCTATCGAAAGAAGACCTCGCCCGGGTATATACAGTGAATGAAATACTGTCAATGCCGGGGGTATCGATTGAGGGATGGCGCACGGCCCGAGGCCCCGCACAGTGCCATAGGTGCCAAGCCTTCGGCCATGCCTCTACGAATTGCCACCGGGCGATCCGCTGCGTACGCTGTGCTGGAGAACACATTGTGGCGGATTGCCCGGGGCCCAAAGAGGGACCATACAAATGCGCCAACTGCGGTAAAAACCACGCAGCCGTGGACAAACGATGCGCGATATTCCGCAGAAAGGCCAGAGCGATGGGAGTCGCTGTACCTCCGTCGGTGCCCCCGACAGGCAAGCCTGGGACTCATACCTCAGACCCCCAATATAATCACAACCCAAACCAGCATAAAAAGCAAACTCAATCTCAAATTGCAAAGGGGAAAGGTAAGGGAAAGGGGAAATCCTCCCTTACCCTCCGTCTCCCCTCTTCAGTACCCCAACATATGAGTACCGTAGAAGCCCAACCATCGGCCTCAAACTTGATGGCAGAAGCAATCATGCCCAAAAAAGCAGGCCCGACTGCCAAATCAAGACCTAAGTCAGGAGACCCAGCAACCCTTATTGGGAAACCAACTGAGCTGGGCCCCCAGACCAATCTAGAAACGGCCAAGAAAAAGAAGAAAAAGAAAAAGAAAAAGAAGGGGAAAGAGAAGGACCAAACCGAACCTACCAACGCAGAGGCAGCACACCCCAAAATACTTCCAAAAAATAAGGAAGTACAGGAGGAAATGGAGGTGGTAGAAGATGAAGAAGAGGATGAAGAAGTCACCAAAGACAAAGACCCCAACAACCCGAAAGAACCTACCTGCACCAGACACACGCAACGCGGGCAGCCTAGCGTAAGCCAGTCACCAAAGACAACTAGCTTTACTAACTGGCTGCGCAAATTATGGGAGAAAGTGTCCGGGGCGATATCGGAAGTAGTACGTGAGATCGCCTCGGGCGCCAGCCCCTTCGGGGCCCTGCTCTCGGGATTCTACCGGTCGGAATTAATCCGACTCGCCCAGGAGTACGACCCACAGGTCATACTCCTGGGCGAGACCAAGCTCAAGCGCCAGCAGAATTTCAGGATGCCCAACTACTTTGTGTACCGAAGGGACGAACTCTCTCCTGCCGGGCTGCCGTTCAGGGGCACTGCGGCGCTCGTCAGGAGGGATGTGGTGCACGACGAGTTGGAGCAGGTGCCCTTCACCTCGACCAGAATGGTGGGAGTGAGGGTGCACACTCCGGAGGCCGAGCTGCGGATATATGCCGCATATCGGCCTCCGGGTCCTGATTTTGCTGAAGCCGACTTCAGACGGATCTTGAACTATGACCCCCGGCCGGCGTTGGTGTTGGGGGACCTCAATGCAAAACATACTGCATGGGGTTCCCGAGTCATCAACGCGCCCGGCAGGAGGTTATACGAGGATGCCGAAAGGGGGGACTATTGCGTAGTCGGCCCCAACGAGCCCACGCACGTCCCGAGCGCGGCCCGGTACCAACCGGACGTACTGGACGTTTGCGTGCACAAGGGGTTACGGTGTCCTCTAACTATAGAGGCGCTGTACGACCTGAGCACCCCGCACCTGCCGATCTTGGTTACGGTAGGTCTGGGGTTAACTCGGGTCGCGACGTCCCCTCTAAGGCCCAGGGTCGACTGGGAGTCTTTTACGAGACTCCTGGCCGACCAATCCCCGGTTCAAGATCCGTCTACCCCTGACGAGGTCGACGCGGCGGCACTCCGCCTTGTCGACATCATCAGGGGAGCACTAGAACAAGCGACGACTCTGGTACCCAGTGGGGGGCCCAGAGAAGGACTCCCGGTGCACCTCAAGACGATGATTCGTCGGAAGAGGGCACTGAGAAGGCTCTGGGCGACATCTAGATGTCCCAGGATCAAGCGCGAGCTCAACCGACTGGAGGAGGAGCTGGCGACTGGGATGCAGACCTTCCGGGGTGACTCCTGGGAGGGGGGGCTATTAGACGCGTCGGAAGACCGTACAATGGCCTCGCTCCACCGCATCTGTCGCCGGCTCACTAACAAGCCTTCCCCCTCCTGTCCACTCGTGGACGAGGGGGGACTTAGGCACTTCTCGGCACAGGCTCGCGCCGAGATCCTGGCCAACTCACTGGAGCGGCAGTTCACACCAAATGTCTCTGCACCCTCAATGGCTGCATTCCACCAAGAGGTTACAGAGGGCGTACTCCAACTCCTCAAATCGGACTCGCCGAGGGAAGAGCTGGGAAACGACGAAAGCATCACACCCAGCGAAGTGCGTCACCTCATCAAAATGATGAAAAGGCGCAAAGCCCCTGGCGAGGACGGTATAACTCCCCCTGCACTCACTAACCTTCCTCACGCAATCGTGTCAGCAATGACACGATTGTTCAACTCCATACTCCGGGTAGGACACTACCCCAAAACCTGGAAGCTGGGCAAAATTATTGTCCTGCCCAAACCCGGCAAGGACAGGAGAGAGCCCTCCAGCTACCGACCGATTACCTTGCTCTCCCACGTGGGCAAGTTGTTTGAGCGGCTGCTCCTGAGGAGAATATCGCCGTATATCCTCCTCAGGCCGGAACAGTACGGCTTTAGAAGCGGCCACTCAACAACTTTGCAACTGACTCGCGTCCTGCATCACTTGGCGGACCGGTACAACTCGGGCCAATACACGGTCGCGGTCTTTCTCGACATCGAGAAGGCCTTCGACCGTGTGTGGCACGAGGGGCTGGTTCACAAGCTGCGGGACGCGGGTCTACCGCTTGCCCACGTGAGACTGCTCGTGTCGTACCTGGAGGGTCGCTCATTCTTTGTCGCGGTCGAGAACGCACGGTCATCCGTGCGTGAAATTTCGGCCGGGGTCCCACAGGGTAGTGTCCTATCTCCTATCCTTTACGCCCTCTATACGAACGATATCCCCACTCTGAAGGATAACCTTCGAGAGTGGGAGGAGGACGTGATGTTGGCACTGTTCGCAGACGACTCTGCCTACTTCGCGTCCTCCCCGTTCCCCTCTGCAGCCATAATGAGGATGCAGAGGCTTCTGGATTTACTGCCCCAGTGGCTGGACCGTTGGAAGGTCGCGGTCAATGTGGGCAAGACTGCGGCTCTTATCCACGGTCCGGTCCGTATCAGAGTCGTCCCCAAGAAACTCAATCTCCGAGGTGTGAATATCGAGTTTAAGCCGAAGGTCCGGTATCTCGGGTGTGACATTGACCGCTCACTGAGCATGGCGGCGCACGCCAGCCGAATTATCGGTTCGGCGAGCGCGGCCAGGTTCATGCTGCGGCCGGTGTTGGTGTCCGGGCTGCCGACCAGGACTAAGCTCGCTATTTACAAGACGTACGTCCGCTCCCGTCTCACATACGCTGCTGCGGCCTGGTACCACCTACTGTCGCCGTCCCAGCGAGCCAGGTTACAGGCCCAGCAGAATCTTTCCCTCCGTAATATCGTCGGGGCCGGGCGGTACGCTCGCTCGTAA
Protein
MPGGISPPIHSTPTTSRRDKPSTVEDPQDYGSHMPPAPSAARAAPGLIERPGTPWGGQDSPRVGPGQTMFPLPADCPETPRPRKKARSESDKGSAEAVDKRPRLGRSVDSSDDSGSSQSVSSSRGSASADSNSSTKTGPRPRPQPKPLHEAPKPASRRERTPPRSPSPTNTLDPMTINKGAPARDNNINITGPKQSTSYATITAQVPPPKQITPSKLTTIPQKEGDREKLKHHPPIMVEALPNWTRHIAAIRERLGRVPSVRPLGRGFRFLPASVNEYRVVQAYLSEASSADSGIKWYCYALAEEIPSRVAIKGLPPDTDAALVVEALKEKGFPARYARCILAKRGRPSCVFFVTLDHLSKEDLARVYTVNEILSMPGVSIEGWRTARGPAQCHRCQAFGHASTNCHRAIRCVRCAGEHIVADCPGPKEGPYKCANCGKNHAAVDKRCAIFRRKARAMGVAVPPSVPPTGKPGTHTSDPQYNHNPNQHKKQTQSQIAKGKGKGKGKSSLTLRLPSSVPQHMSTVEAQPSASNLMAEAIMPKKAGPTAKSRPKSGDPATLIGKPTELGPQTNLETAKKKKKKKKKKKGKEKDQTEPTNAEAAHPKILPKNKEVQEEMEVVEDEEEDEEVTKDKDPNNPKEPTCTRHTQRGQPSVSQSPKTTSFTNWLRKLWEKVSGAISEVVREIASGASPFGALLSGFYRSELIRLAQEYDPQVILLGETKLKRQQNFRMPNYFVYRRDELSPAGLPFRGTAALVRRDVVHDELEQVPFTSTRMVGVRVHTPEAELRIYAAYRPPGPDFAEADFRRILNYDPRPALVLGDLNAKHTAWGSRVINAPGRRLYEDAERGDYCVVGPNEPTHVPSAARYQPDVLDVCVHKGLRCPLTIEALYDLSTPHLPILVTVGLGLTRVATSPLRPRVDWESFTRLLADQSPVQDPSTPDEVDAAALRLVDIIRGALEQATTLVPSGGPREGLPVHLKTMIRRKRALRRLWATSRCPRIKRELNRLEEELATGMQTFRGDSWEGGLLDASEDRTMASLHRICRRLTNKPSPSCPLVDEGGLRHFSAQARAEILANSLERQFTPNVSAPSMAAFHQEVTEGVLQLLKSDSPREELGNDESITPSEVRHLIKMMKRRKAPGEDGITPPALTNLPHAIVSAMTRLFNSILRVGHYPKTWKLGKIIVLPKPGKDRREPSSYRPITLLSHVGKLFERLLLRRISPYILLRPEQYGFRSGHSTTLQLTRVLHHLADRYNSGQYTVAVFLDIEKAFDRVWHEGLVHKLRDAGLPLAHVRLLVSYLEGRSFFVAVENARSSVREISAGVPQGSVLSPILYALYTNDIPTLKDNLREWEEDVMLALFADDSAYFASSPFPSAAIMRMQRLLDLLPQWLDRWKVAVNVGKTAALIHGPVRIRVVPKKLNLRGVNIEFKPKVRYLGCDIDRSLSMAAHASRIIGSASAARFMLRPVLVSGLPTRTKLAIYKTYVRSRLTYAAAAWYHLLSPSQRARLQAQQNLSLRNIVGAGRYARS

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.000104741,     Score=114

Ontologies

GO

Topology

Length:
1526
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03745
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1526
 
 

Population Genetic Test Statistics

Pi
223.782439
Theta
160.385607
Tajima's D
1.046992
CLR
119.859974
CSRT
0.672016399180041
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号