SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07478
Pre Gene Modal
BGIBMGA005207
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.752 Nuclear   Reliability : 1.4
 

Sequence

CDS
ATGGAGTCCACGATCGATCTGTTCGCGGAATTCCTCCGTCTGAGGTACCCGACATTATCGGCCGAATTTTTAGAATTTAAGGCCAATCACGCCGCGAACTCAGAAGCGGTCTCCGTCGCGCCCGCCGCTCCCGTGTCCCCAATACTCGCGAGCAAAGCTCCCGCGTCGATCGCTGCGGTCTCGGTTCCAGCCCTGCGCTCATCCGCAGCACACGTCGCGTCCACGCGTTCATCCGCGGCCTCCATCGCGCCCGCGCCGTCCTCTGCCCCCGAGCGATTGTCCGTGGCCTCCGTCGCGACCGTCAACCCCGCGCCCTCTAAAACGCCCGCCTGCGGGTCGCCCGCGCCCTCCTCTTCATCCGACTCGGAGTCGGACATGGAGGTCGATCTTTCCCCCGCCCCCTCGACTGATGGATTCATAGTAGTCCAAAAAGGTAAGAGGCGCGCTGCGGAAGCCCGAGCTCCCGCGGCCGCCAAAGTAAGCAGAGCCGCGAACGCGTCGCGCCTCCGTCCACCGACCCCCGTTGCTCCCCCAGCCCGTGCTACACCGTCGCCGCGTCCGGTAGTACAAAAGAAAATTCAAGCCCCTCCCCCGGTAATCCTTCAAGAGAAGGCAGCCTGGGAACGAGTTTCCCTGGCCCTTAAGGCCAAAAATATTAATTTCACGAATGCCCGTAACCTCGCGAACGGCATTCAAATTAAGGTTCAAACACCCGACGACCATAGGGCCCTCTTTTCTTACCTCCGTAAGGAGCGTATAAGTTTCCATACGTATACGCTCCAGGAGGAGCGCGAACTTCGTGCCGTCATACGTGGCATCCCTAAAGAGTTGGATGCCGAACTCGTCAAGGCCGACCTTCTGGAACAAGGCCTACCAGTAAATTCAGTGCACCGCATGCACACCGGCCGCGGAAGGGAGCCATATAATATGGTTCTAGTCGCCCTCCAGCCTACCCCCGAGGGTAAGCAAATTTTTAACATACGGACCGTCTGTAGGCTCTCCGGTATCGCCGTCGAAGCCCCCCATAAAAAAGGCACTCCTAGCCAGTGCCATAACTGTCAACTGTACGGGCATTCTTCCCGTAACTGTCACGCGCGCCCCCGATGCGTCAAGTGTCTAGGCGATCACGCTACGGCCCTTTGCACTCGCGATCAAAAAACCGCGACGGAACCGCCTAGCTGCGTCCTGTGTCGAACACAGGGTCACCCCGCAAATTACCGCGGATGCCCCCGAGCCCCGAAAATAAATCGCCGCGTCGCCCGCCAAAACCGCCTCCGAGCTTCCCACCCAGACATCAAAGCCTCGGCACCCTCTGTGTCGCAGGCTAAGCCAGCGTTCGTTCCGGCGCCGGTGCCCAGTGGCTCGGCCTGGGCGAAACCGCTGCCGTACACGAACACGGCTACAACTCCCTCCTCCGCGATTCGTCCCGCCCCCGCGATACGCCCCTCCCCCGCGAATTGCCCTCCGACAGCGTCCGACAATCTTGCTCTAGCGATCGACTTCTTTCAATCGATTAACTTTGAGCGCGTTAACGCTTTAGGTGACGCCATCCGCGCCGCCTCCACTGCACAGCACTTCATCGCCGTTGTGCAAGAATACGCCGACGTATACGCGTCGTTAAATACGAACGACAGGCTCACTGCTCGTGGTGGTGGTACCGTCATCTACTACAGAAGAGCCTTGCACTGCATTCCGCTCGATCCCCCCGCGCTCGTTAACATCGAAGCATCAGTATGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCAGCATGGGAAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAAGTCTCACACCACAACCCCTAATGGCAGGCGGCTCGACGAGCTAGTCGATGATCTCGCCTTCGATATCATCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAGCTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTATGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAGCCCGGACTCTACCCCGTCTCTTCATGATACCGCTGAAGCCATAGACATCCTAACGTCACACATTACCTCGACATTAGATAGGTCATCGAAGCAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCGAATTGCCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCTTCGATCCGCGCCTACGATAGGTATCCTACCGTGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGGTGGTCTGATTTCTTAGAAGGACTCGCGCCCTCTCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTTGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGTCGACTCGCGGCGTTTGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCATTCAATCCGCGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCGGATGCGTTACCACCCGTCACCCCAATGGAAGTTAAAGACCTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTCTACCCATCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACACAAACCCGGTAAACCAAAAAATAATCCGACGAGTTACCGCCCGATTAGCCTCCTCATGTCTCTGGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCAAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTGCAAATCACTCATGCGTACAACAGGTGCACCGCCTCACGGAGCACATTCTTGTAGGACTTAACCGACCAAAACCGATCTATACGGGAACCCTCTTCTTCGACGTCGCAAAAGCTTTCGACAAAGTCTGGCACAACGATTTGATTTTCAAACTTTTCAACATGGGCGTACCGGACAGTCTCGTGCTCATCATACGAGACTTCTTGTCTAACCGCTCTTTTCGATATCGAGTAGAGGGAACCCGCTCCTCCCCGCGACCACTCACGGCTGGAGTCCCGCAAGGCTCCGTTCTCTCTCCGCTCCTATTTAGTTTATTTATTAACGATATTCCCCGGTCGCCGCCGACCCAGCTAGCCTTATTCGCTGACGACACAACCGTTTACTACTCAAGTAGAAACAAGTCCCTAATCGCGAGTAAGCTCCAGAGTGCAGCGTTAACCCTCGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGCACAGCAGTGTTATTTCAAAGGGGAAACTCACCGCTTATTTCCTCCCGCATTAGGAGGAGAAATATCACACCCCCGATCACCCTCTTCGGCCAACCTATACCCTGGGCTAGGAAGGTCAAGTACCTGGGAGTCACCCTGGATGCATCCATGACATTCCGCCCGCATATAAAAACAGTCCGCTATCGTGCCGCATTTATTCTCGGCAGACTCTATCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGATCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCCGTCGGGGCTCCGTGGTTCGTGAGGAACGTCGACCTACACGACGACCTGGGCCTCGAATCGATCCGCAAACACATGAAATGGGCTAGTAATCTTCGTTCGACCACAGACAGCTACCTCCACAATCCAGGGTCAGAACCTTTGACGTTAGCGACGCTCGGTGACATCATCGAAGAGACAGTTCATAAATTTCCTGGTAGAGTGGCCGTGAAGTCAATGCACGAAGGCATCAGTCTTACCTATGAGGAGTTGTTAATACGGGCGGATTCTATGGCATATGGTCTTCGAAATCAAGGACTACAAAAAGGCGATCGAGTAGGAATCTGGTCACATAACAGCGTTTCTTATTTAGTTTCCTTAGTGGCAGCAGCCAGAGCTGGTTTGATTTCGGTTTTAATCAATCCAGCATATGAAAAGAAGGAACTAAGTTTTTGCATTAAGAAATCAGAAATGAAGTGTTTACTGATAGGCGATGCTCTACCGAAGAGGGAGTATTACAGAACTTTAGAGCAATTAATACCTGAATTAAAAGACGGAAAGCCGGGGTTATTAAAGTCTAGAGAATTTCCTTTTTTATCTTCAATTATTGCTGATGGTAGGAACAAATTGCCTGGTACTATCTCATACAAATCGTTGACCGAGGATTATAAGAACAGAAGCGAAGTGTCACAATACGTCAAGGAAACCAAACCAAGTGACGGTTCTATCATTCACTTCACTTCCGGTACCACAGGGGAACCGAAAGCCGCATTGGACTCGCACCTCGGCGTTGTAAACAACACTTACTTTACAGGCAAGAGAAATACTTTCCACGAAGGACATCATAACATTTGTGTTCAGGTTCCAATATTCCACGCTCTCGGATCCATCGTGACAGTACTGGGAGGCTTCCGTCACGGGGCCAGCCTGGTGCTAGCCGCACCTATTTACGACATCTCTGCAAATGTGAAAGCTTTGTTTGGTGAAAAGTGTACAGCAATAACAGGCACTCCCACCATGTTCGTAGACATCTTATCCCAGATCAGAGCCCAAGGTCAGGAGGTGCTTTCTGAACTCCGGGTGGCGGTCGCCGCCGGAGCGCCCTGCAGCCCCCAATTAATTAGAGATATACAAACACATCTCAATGCTGAATCAGTTAAAAGTCTGTACGGTCTAACTGAGACAACAGCTTGCATATTCCAGTCCAACCAAGGCGACAGTATAGACGTCGTAGCCGAGACAGTTGGTTATATTCAAGATCACGTTGAAGTCAAGGTGGTAAACGAACAAGGGGAGATCGTTCCGTTTGAAACACCGGGCGAGCTTGTTGTACGCGGCTACAACAACATGATCTGCTACTGGAACGAACCGGAGAAGACTAGGCAAACTCTGGACAAAGACGGCTGGCTGAAGACCGGGGACAAGTTCACGATAAGCAAAGACGGCTACGGCAGGATAGTTGGAAGGATTAAAGATATCATCGTTCGAGGAGGGGAGAACATCGCGCCGAAAGAAATAGAAGATTTGCTGAACACACATCCCGATGTTGAAGAAAGTCAGGTCGTCGGAGTGTCGGACAAAAGAGTTGGAGAAGAGCTCTGTGCTGTTGTGAGGCTGCGTGAAGGCGCTGCGTTGAGTCTCGACGACGTAACAAAGCATTTAACAGGAGAAATCGCACGCTTCAAATTCCCGAGGATCCTCAAAGTCACACAAGAGTTCCCGAAGACCGCTTCAGGGAAGATCCAAAAGTATAGACTGAGAGAAATGATCGAGAAAGGACTATTGTGA
Protein
MESTIDLFAEFLRLRYPTLSAEFLEFKANHAANSEAVSVAPAAPVSPILASKAPASIAAVSVPALRSSAAHVASTRSSAASIAPAPSSAPERLSVASVATVNPAPSKTPACGSPAPSSSSDSESDMEVDLSPAPSTDGFIVVQKGKRRAAEARAPAAAKVSRAANASRLRPPTPVAPPARATPSPRPVVQKKIQAPPPVILQEKAAWERVSLALKAKNINFTNARNLANGIQIKVQTPDDHRALFSYLRKERISFHTYTLQEERELRAVIRGIPKELDAELVKADLLEQGLPVNSVHRMHTGRGREPYNMVLVALQPTPEGKQIFNIRTVCRLSGIAVEAPHKKGTPSQCHNCQLYGHSSRNCHARPRCVKCLGDHATALCTRDQKTATEPPSCVLCRTQGHPANYRGCPRAPKINRRVARQNRLRASHPDIKASAPSVSQAKPAFVPAPVPSGSAWAKPLPYTNTATTPSSAIRPAPAIRPSPANCPPTASDNLALAIDFFQSINFERVNALGDAIRAASTAQHFIAVVQEYADVYASLNTNDRLTARGGGTVIYYRRALHCIPLDPPALVNIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLSMGSSVILAGDLNCKHIRWKSHTTTPNGRRLDELVDDLAFDIIAPLTPTHYPLNIAHRPDILDIALLKNVALRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTMVDWHTLGISLAESDPPSLPFSPDSTPSLHDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFELPDDIRELLRAKNASIRAYDRYPTVENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSIQSADPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPIQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNNPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRANHSCVQQVHRLTEHILVGLNRPKPIYTGTLFFDVAKAFDKVWHNDLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFINDIPRSPPTQLALFADDTTVYYSSRNKSLIASKLQSAALTLGQWFRKWRIDINPAKSTAVLFQRGNSPLISSRIRRRNITPPITLFGQPIPWARKVKYLGVTLDASMTFRPHIKTVRYRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVIAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKHMKWASNLRSTTDSYLHNPGSEPLTLATLGDIIEETVHKFPGRVAVKSMHEGISLTYEELLIRADSMAYGLRNQGLQKGDRVGIWSHNSVSYLVSLVAAARAGLISVLINPAYEKKELSFCIKKSEMKCLLIGDALPKREYYRTLEQLIPELKDGKPGLLKSREFPFLSSIIADGRNKLPGTISYKSLTEDYKNRSEVSQYVKETKPSDGSIIHFTSGTTGEPKAALDSHLGVVNNTYFTGKRNTFHEGHHNICVQVPIFHALGSIVTVLGGFRHGASLVLAAPIYDISANVKALFGEKCTAITGTPTMFVDILSQIRAQGQEVLSELRVAVAAGAPCSPQLIRDIQTHLNAESVKSLYGLTETTACIFQSNQGDSIDVVAETVGYIQDHVEVKVVNEQGEIVPFETPGELVVRGYNNMICYWNEPEKTRQTLDKDGWLKTGDKFTISKDGYGRIVGRIKDIIVRGGENIAPKEIEDLLNTHPDVEESQVVGVSDKRVGEELCAVVRLREGAALSLDDVTKHLTGEIARFKFPRILKVTQEFPKTASGKIQKYRLREMIEKGLL

Summary

Uniprot
ProteinModelPortal
PDB
3CW8     E-value=5.64642e-46,     Score=471

Ontologies

Topology

Length:
1916
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.871899999999997
Exp number, first 60 AAs:
0.00116
Total prob of N-in:
0.00006
outside
1  -  1916
 
 

Population Genetic Test Statistics

Pi
19.876068
Theta
20.836142
Tajima's D
-1.646046
CLR
11.373618
CSRT
0.0440977951102445
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号