SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07435
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
RNA-directed DNA polymerase from mobile element jockey       + More
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.372 Nuclear   Reliability : 2.061
 

Sequence

CDS
ATGGAGGAAAAACTTTTCATCGACTTCATTCGGGAAAAATATCCGTCAATCGCGCCCGAATTCGAAGCCTATAGGGCCTCATTTGGTAATTATTCTCCCCCCGCATCTCTCGCCGCCGTCGCCAAACATGCCTCGCAGGCATGCCTCGCGTGCCCCGCCGCCGGTCCGTGTTCAAGCGAGGACCGCGAACTCCGCGTAGTGATACGTGGAGTCCCCAAGGAACTCGACATAGACTACGTAAAGGAGGATCTGATCGGTCAGTCCCTCCCAATAATTAGTGTGCACCGGATGCACAGCGGACGCGGCAGACAGCCGTACAATATGATTCTCGTCGCGCTAGAATCAACCCCGGAGGCAAAGAAAAGAATCTCATGTCTCAAAACGATATGCGGCCTCTCCGGGGTCACCATCGAAGCCCCCATAAACGTGGTACTCCCGGGCAGTGCCACAGCATTCTACAATGCTAACGGACTCGCGCGGCAACGCGATCAAATTTTCGAATTCCTCCGCGATAATCTTGTAGATATTTTGTTAGTGCAGGAGACCTGTCTGAAGCCCTCGCGTCGTGACCCGAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTATAGGCGGGCTCTGCACGTTGTTCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTCCTGAGCAGTGACATCGAGTCACTGTTTGGCATGGGAGACTCCGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGTACGAACGTTAACGGTAGGCGTCTCGACGCGTTTATAGACGACCTCACTTTTGAAGTAGTCGGTCCCCCAACTCCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCATTGCTTAGGAACGTAACTCTGCGCTTACGTTCCATCGAAGCACTGTCAGAGCTCGACTCAGACCACCGACCTGTCCTTATGCAGCTCGGTCGCCCTCACAACCCAGCCACTGTTACGAGGACCATGGTGGATTGGAATAAGCTGGGCACGTGCCTAGCCGAAGCCGCTCCGCCAATCCTCCCTTACGGCCCGGATACGAATCTATCCCCCGAGGACACCGTCGAATCCATAAACATCATTACCGATCACATCTCTTCCGCGATCATTAGATCTTCAAAAGAAGTCGATGTGGAGGACAGCTTCCACCGCATCAGACTGTCCTCCGAACTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGACCGTCTTCCCACGCATTCAAACCGGATTAGGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCCTAAGTGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCGTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTGACGAAGTTAGAGACGCGATACACAACCTCCAACCTAGGAAGGCACCCGGCTCCGACGGCATCCGCAACCGCGCGCTAAAACTCTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGTATACATAAGCCGGGCAAACCGACAAACGAAACTTCTAGTTACCGTCCGATTAGTCTCCTCCCGACGATAGGAAAAATTTACGAACGGCTCCTTAGGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCTAAACACTCGTGCGTACAACAAATGCACCGCCTCACGGAGCACATCCTGATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTACAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACTGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAAAGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTTTTCGGCGACTCCAGATCGCAGTAGCCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAATACCACTTCGAGCATCCCACTCCCTAATAGGCGCGCAAACACCTCCGCCGTTAGCCCCGTCACTCTCTTTGGCCAGCCCATACCGTGGGCCTCGCAGGTCAAATACCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCATATTAAAACGGTACGCGACCGTGCCGCCTTCATATTAGGACGTCTCTACCCTATGCTTTGCAAGCGAAGCAAACTGTCCCTCCGTAATAAGAACTAG
Protein
MEEKLFIDFIREKYPSIAPEFEAYRASFGNYSPPASLAAVAKHASQACLACPAAGPCSSEDRELRVVIRGVPKELDIDYVKEDLIGQSLPIISVHRMHSGRGRQPYNMILVALESTPEAKKRISCLKTICGLSGVTIEAPINVVLPGSATAFYNANGLARQRDQIFEFLRDNLVDILLVQETCLKPSRRDPKVANYVMVRNDRLTASKGGTAIYYRRALHVVPLDTPSLLHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEVVGPPTPTCYPYNIALRPSTIDLALLRNVTLRLRSIEALSELDSDHRPVLMQLGRPHNPATVTRTMVDWNKLGTCLAEAAPPILPYGPDTNLSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSSELRNLLRVRNAAIRAYDRLPTHSNRIRMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLVRPSGQPPAFDDDDKAELLADALQEQCTTSTQHADPEHTELVDREVERRASLPPSDALPPITTDEVRDAIHNLQPRKAPGSDGIRNRALKLLPVQLIAMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPTNETSSYRPISLLPTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQMHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYIKDIPRSPETHLALFADDTAIYYSCRKMSLLFRRLQIAVATMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTSSIPLPNRRANTSAVSPVTLFGQPIPWASQVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCKRSKLSLRNKN

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    KQ973342    KXZ75569.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    KQ973412    EFA12510.2    GBBI01004395    JAC14317.1    GALX01005359    JAB63107.1    GALX01005299    JAB63167.1    GGMR01018716    MBY31335.1    GBBI01004571    JAC14141.1    ABLF02008153    ABLF02008462    ABLF02008464    S59870    AAB26437.2    GGMS01002992    MBY72195.1    RPOV01000134    RPJ78669.1    ABLF02042518    ABLF02057746    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    NEVH01011985    PNF31054.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    GGFL01005012    MBW69190.1    GGFL01004957    MBW69135.1    GGMS01006359    MBY75562.1    NEVH01005277    PNF39135.1    NEVH01021205    PNF19912.1    NEVH01006736    PNF36716.1    GGFJ01001844    MBW50985.1    GFTR01008279    JAW08147.1    GGMR01013409    MBY26028.1    GGFJ01001843    MBW50984.1    GGFJ01001842    MBW50983.1    ABLF02023911    KK119692    KFM76444.1    ABLF02034467    GFTR01008261    JAW08165.1    NEVH01017470    PNF24199.1    GFTR01008038    JAW08388.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    KK119261    KFM75202.1    GGMR01004661    MBY17280.1    GGMR01003407    MBY16026.1    GGMR01000676    MBY13295.1    GFTR01008271    JAW08155.1    NEVH01023280    PNF18085.1    L79944    AAB04627.1    GFTR01008262    JAW08164.1    ABLF02040174    ABLF02040183    ABLF02055266    KK118005    KFM71947.1    GGMS01017365    MBY86568.1    GGMR01012305    MBY24924.1    GFTR01008256    JAW08170.1    GFTR01008151    JAW08275.1    ABLF02024246    NEVH01016302    PNF25823.1    ABLF02028535    ABLF02028545    GFTR01008254    JAW08172.1    GEZM01084969    JAV60363.1    GFTR01008251    JAW08175.1    GGMR01016905    MBY29524.1    ABLF02022418    GFXV01000908    MBW12713.1    NEVH01026386    PNF14434.1    GGFL01005122    MBW69300.1    GGFL01005121    MBW69299.1    NEVH01020940    PNF20481.1    GGFJ01002256    MBW51397.1    LBMM01018163    KMQ83860.1    GFTR01007929    JAW08497.1    KF280391    AIE77315.1    GGFJ01002257    MBW51398.1    GFTR01008269    JAW08157.1    GDHC01020244    JAP98384.1    M22874    M38643    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GECL01003538    JAP02586.1    KK113281    KFM59799.1    RSAL01000708    RVE41206.1    GBGD01000389    JAC88500.1    GFTR01008257    JAW08169.1    NWSH01007753    PCG62823.1    GGMR01000226    MBY12845.1    KQ973363    EFA13335.2    GBHO01008295    JAG35309.1    GFTR01008260    JAW08166.1    GGMR01006408    MBY19027.1    GEDC01000337    JAS36961.1    GGMR01012443    MBY25062.1    AY060438    AAL25477.1    GEZM01053022    JAV74219.1    GGMR01003864    MBY16483.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.00437733,     Score=98

Ontologies

Topology

Length:
953
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.890829999999999
Exp number, first 60 AAs:
0.00018
Total prob of N-in:
0.00283
outside
1  -  953
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
16.780137
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号