SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07433
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 2.788
 

Sequence

CDS
ATGTCTGGTGGGGCTTCTCCCCCCATCGTCAGCACACCCGGCCCGTCCCGGAAGGGACGTCAAGCAATGGACGAATTATACGCCCGTCGCCCAATCCCACGAACCCGACCGGTCCCGATGGACCCCGGTAAGGACGATTCGGCCGGACCTTCGGTCTCGGCCCGGGACTCCCAGGGGATCGGACCGGGGGAAGGTTCCCTTCCCTTGTTGACCGATCACCCTGGGACTCCTCGGCCGAGAAAGAAGGCCAGGCCGAGGGGTCGGGCCCAGGAGGAGCTCCGCCGTCATCCACCTATCATGGTGGAAGCTCTCCCGAACTGGTCTCGCCATATGGCGGCCATTAGGGAGCGCCTCGGTAGGGCTCCTTCTGCCAGACCCCACGGCGCCGGTTTCCGCTTCCTGCCGTCATCGGCGGAGGAGTATAGGGTGATTCAGGACTACCTTTCGAGGGCCTCCGCCGCAGACAAAGCCATTAAATGGTTTTGTTATGCGCTGTCGGAGGAAATACCCTCGAAGGTGGCTGTCCGGGGTCTCCCTGCTGACACCGATGCGGCGGAAGTAACAAACGCCCTCAAGGAGCTGGGCTTTCCTGCCCGATATGCCCGGTGTATCCAGGCTAAGAGGGGGAGACAGGGCTGCGTATTTTTCGTGGCTCTGGACCACCTCTCCAAGGGTGACCTCGCCCGGCTGTATTCAGTTAACGAACTGTTATACTTGCCGGGGGTGACGGTCGAGGGATGGCGTCCAACCCGGGGGCCTGCGCAGTGTCACCGCTGCCAGGCCTTCGGGCACGCGTCCACGAACTGTCACCGTGCGGTCCGCTGCGTTCGATGTGCCGGCGAGCACATTGTGGCGGACTGCCCGAGGCCAAGGGATGGCCCATTATCCTGCGCTAATTGCGGGAAGGACCACGCCGCCACCGATCGGCGGTGTGTGGTATACCGCAAGAGGGCCAGGATGATGGGAGTAACCATCCCCCCTCCTGTTCCACCGGTGCCTCGGCCCAGGAATGTCCCAGCTCCAGTAGCTGCTCCTGTGTCCGCACCCATCCCCAAGGGGAAGGGGAAGGGGAAAGGGAAATCCTCCCAAACCCCAGCCCCTCTCCCTCCTAGTACCCTTCCGTCTACCTCGGTAGTGGAGGCTATGCCGTCAGCGGCCACGCTGATGGCACAGGCAAACCCGCCGAGGCGAACAAACAAGCCTGTCCCTACTCCTCGTGGTCGAGCTTCCTCTACTACCACAACAGTAAGCAAGCCAGCGCCTCTCACTCAGAACATCCAGAGCACGTCCACAGTCAACAGAAAGAGGGAGAAAAATAGGAAGAAAAAGCTGAACAGGAAATTAAGAAAAATAAAAGAAAAAGAGGCAAACACTAACAATCCACCCATTACGACCGAGCCAGTTGTGCCGGACCTTCAAACCACCCAAGCTGAGGCAATGTCTACTACTGAGGCCTCACACATCGACCAACCTTCGACTAATGAAGGCCCGGTATTATCCGAGGCCCATCAAAGCGTGCCACCTTACACTAGTCAGCCTCCTCTTCCCCCCCGCCCTCAGCGCGAGCAGCGCAGCGGTCGGCAGGCCTCACAACCTGCCGGCTTTGCTGCATGGCTCCTCGCGCTCTGGGAGAAATTGTCTGAGGAACTGCGCATCATTTATTGGAACCCCGGCGGGGTAAAACCCCGCAAGAACGAACTCTTGGTCCTCGCCCGGGAGTACAACCCTGAGGTTGTGCTCCTGGGCGAGACCAAGCTACGTCCTCGGGATGTGTTCAGGATTCCAAACTACTTCATGTACCGACGTGACGAGGTGAGTCCTGCCGGGACGCCGTTCAGGGGCACTGCGGCGCTCGTCAGGCGAGACGTGGTACATGATCAGTTGGATTTGCTGGCCTTCACATCGACAAGACCCCCGGGGCCTGATTTTCATCCCGGGGACATAAGAAGGGTCCTGAATTGCGACAGCCGCCCAGCTCTGCTGGTCGGGGACCTCAACGCGAAGCACGTCGCGTGGGGCTCCCGACTGAACTCAGCAGTGGGCAGGCGGCTGTTAGAAGATGCCGATAGGGGCGACTACTCTGTGGTCGGCCCCGACGAACCCACGCACATTCCGACCGCCGCGCAACTCCAGCCCGACGTGTTGGATGTGTGCGTTCACAAGGGGCTACGGTGCCCCTTAACTATTGAGGCACTGTACGACCTGGGTACCCCCCATCTCCCTATCCTGGTCACACTGGGAATGGGGCTTACCCGGGTTGCGACCTCGCCCCTACGACCGAAGGTCGACTGGGAGCTCTTTAAGAGACTCCTAGTCGACCTTCCCGTAATTCAGGACCCCAACACCCCTGAGGGGGTCGACGACGCGGCAGTCCGCCTTGTCGACTCTATCAGGGGAGCGATCGACCAGGCGACGACTCTTGTGCCCAGCGGCGGGCCCAGAGGTATACTCCCGGCCCATCTGAAAGCGATTATTCGCCGGAAGAGGGGCCTGAGGAGGCTCTGGGCGACAACTCGTTGTCCCAGGATCAAGCGCGAGCTTAATGAGCTGGAAGCGGAGTTGGCGGCGAAGATTAGCTCCTATCGGGGCTATGCGTGGGAGGAACGGATCGAGGAGGCCCGTGAGGGCCCCTCGTCCGTGTCCCTCCACCGACTTTGCCGCCAGCTCTCAAATCGGCCTGCCCCGACTTGTCCACTCGTGGACGAGAGGGGCAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATGTCCTGGCCGTAATGCTGGAGCGGCAGTTCGCTCCAAATAACTCTGCACCCTCAGAGGCCGCATTCCACCAATCGGTGGAAGAGAGCGTAGCAAGCCTACTCTCCTCCCCGGTGCCACCGTTGGGAGATGGTGATTTCATCACTCCCAGTGAATTGCGCCTCTCCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGCGAGGACGGTATTCCCTCCCTCGCATTTTTCCACTTCCCCGAAACGGTCGTGTCATTCATGACACGACTGTTCAATTCCATTCTGTCCACAGGACACTTCCCGGGAACTTGGAAATTGGGCAAGGTTATTGCCCTGCCCAAACCCGGCAAGGATAGGAGAAATCCCTCCAGTTATCGTCCGATCACTCTGCTGTCGCATATGGGCAAGTTGTTCGAGCGGCTGCTGCTGAGAAGGGTGTCGCCGCACATCCTTCTCAGACCCGAGCAATTCGGGTTTCGCAGCGGTCACTCGACAACGCTGCAATTGGTCCGCGTTATGCACCACTTGGCGGATCGGTCCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGATATCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGATCTACAAGCTGTTGCAGAACACGGACCTCCAGCACGCCTATGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCCTTGTCGCGGTCGAGGGCGCAAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCACAGGGAAGCGTCCTGGCACCAGTCCTCTACGCTCTCTACACCAACGACATTCCCACGCTTGAGGGCAACCTCCAAGCGTGGGAAGCCGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCTCGTCCTCTAATTTCCCCTCTGCGGCCATTTCGAGGATGCAGAGGCTGTTGGACCTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACCGCGGCTATCCTTTTCGGTCCGGTCCGCACAAGAGCCGTCCCAGGACAGCTCAGTCTCCGTGGAGTCAATGTCGAGTTTAGGCCCAGTGTCCGATACCTGGGAGTCAATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAAGTCGGCGTTGGCGGCCGCCCGCTATGCGAGGTTTCTCCTCCGGCCGGTGTTGGCCTCCAGGTTGCCGACCAGGACTAGACTCGGCATTTACAAGACGTATGTCCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGATCATGCGGGTGAAGTTACAGGCCCAGCAGAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGAAATGACGTAATCGCCCGGGATCTAGATGTGGAGTCGCTCGAGGAGTTCATTCGGAGGCTAGCTCGTAATATGTACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTCAGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGGTAAGATAG
Protein
MSGGASPPIVSTPGPSRKGRQAMDELYARRPIPRTRPVPMDPGKDDSAGPSVSARDSQGIGPGEGSLPLLTDHPGTPRPRKKARPRGRAQEELRRHPPIMVEALPNWSRHMAAIRERLGRAPSARPHGAGFRFLPSSAEEYRVIQDYLSRASAADKAIKWFCYALSEEIPSKVAVRGLPADTDAAEVTNALKELGFPARYARCIQAKRGRQGCVFFVALDHLSKGDLARLYSVNELLYLPGVTVEGWRPTRGPAQCHRCQAFGHASTNCHRAVRCVRCAGEHIVADCPRPRDGPLSCANCGKDHAATDRRCVVYRKRARMMGVTIPPPVPPVPRPRNVPAPVAAPVSAPIPKGKGKGKGKSSQTPAPLPPSTLPSTSVVEAMPSAATLMAQANPPRRTNKPVPTPRGRASSTTTTVSKPAPLTQNIQSTSTVNRKREKNRKKKLNRKLRKIKEKEANTNNPPITTEPVVPDLQTTQAEAMSTTEASHIDQPSTNEGPVLSEAHQSVPPYTSQPPLPPRPQREQRSGRQASQPAGFAAWLLALWEKLSEELRIIYWNPGGVKPRKNELLVLAREYNPEVVLLGETKLRPRDVFRIPNYFMYRRDEVSPAGTPFRGTAALVRRDVVHDQLDLLAFTSTRPPGPDFHPGDIRRVLNCDSRPALLVGDLNAKHVAWGSRLNSAVGRRLLEDADRGDYSVVGPDEPTHIPTAAQLQPDVLDVCVHKGLRCPLTIEALYDLGTPHLPILVTLGMGLTRVATSPLRPKVDWELFKRLLVDLPVIQDPNTPEGVDDAAVRLVDSIRGAIDQATTLVPSGGPRGILPAHLKAIIRRKRGLRRLWATTRCPRIKRELNELEAELAAKISSYRGYAWEERIEEAREGPSSVSLHRLCRQLSNRPAPTCPLVDERGNRCFSAQARADVLAVMLERQFAPNNSAPSEAAFHQSVEESVASLLSSPVPPLGDGDFITPSELRLSIKRMKRRKAPGEDGIPSLAFFHFPETVVSFMTRLFNSILSTGHFPGTWKLGKVIALPKPGKDRRNPSSYRPITLLSHMGKLFERLLLRRVSPHILLRPEQFGFRSGHSTTLQLVRVMHHLADRSNARQYTAAVFLDIEKAFDRVWHAGLIYKLLQNTDLQHAYVRLLGSYLEGRSFLVAVEGAKSSVRPVTAGVPQGSVLAPVLYALYTNDIPTLEGNLQAWEADVKLALFADDSAYFSSSNFPSAAISRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTRAVPGQLSLRGVNVEFRPSVRYLGVNIDRSLRMTAHAKSALAAARYARFLLRPVLASRLPTRTRLGIYKTYVRSRITYAAAAWYHLIPQIMRVKLQAQQNLALRTIVGAGRYVRNDVIARDLDVESLEEFIRRLARNMYERADGGPHEHLHNIAPLHARPPDGQALPRELLEPPAMVR

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.000205376,     Score=111

Ontologies

Topology

Length:
1432
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02812
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1432
 
 

Population Genetic Test Statistics

Pi
4.278405
Theta
14.075601
Tajima's D
-1.184354
CLR
16.046375
CSRT
0.105694715264237
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号