SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06948
Annotation
PREDICTED:_uncharacterized_protein_LOC105842998_isoform_X1_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.017
 

Sequence

CDS
ATGGTGGAGGCCCTTCCAAATTGGTCCCGCCACATGGCGGCCATTAGGGAGCGCCTAGGCCGCGCCCCCTCGGCCCGACCCTTCGGCGCCGGTTTTAGATTTCTGCCGACGTCGGTTGAGGAGTATAGGGTGGTCCAGGCCTACCTGTCGGAGGCCTCTGCCAGGGACGGTACCATTAAATGGTACTGTTACGCCCTGGCGGAGGAGATGCCTTCGAAGGTGGCGGTCCGGGGCCTCCCTGCCGACACCGACGAGGCAGAAATCGTCAATGCCCTGAAGGAGCTGGGATTCCCGGCTCGATATGCCAGGTGCATTAGGTCCCAGAGAGGGCGTCCGGGCTGCGTGTTTCACGAAGCCCTGGATCACCTCTCGAAGGACGGCCTCGCCCGCTTGTACGCAGTCAACGAACTGCTGTACCTGCCGGGGGTGACGGTTGAAGGATGGCGTCCAACCCGAGGACCTGCGCAGTGTCATCGCTGCCAGGCCTTCGGACACGCCTCCTACAACTGTCATCGCGCGGTCCGTTGCGTAAGGTGTGCCGGGGAGCACATCGTAGCGGACTGCCCGAGGCCGAGAGACGGCCCATTCTCCTGTGCTAATTGCGGGAAAGACCATTCCGCCGTCGACAGACGGTGTGCGGTCTACCGCAAACGGGCCAGGATGATGGGAGTAACCGTCCCTCCTCCTGCGCCACAGGCGCCTCGAGCCGGGAGTGCAGCTCTTCTGGCATCTCAACCAGTACCAAAATGGAAGGGGAAGGGGAAAGGGAAATCTTCCCAGCCCCCTCCCCTTTCCCACTCCGCTCCGTCTGCTGTGGTGGTGGAGGCGTCGCCATCGGTGTCCACACTGACGGCACAGGCTAACCCGCCACGGCAGACAACCAAATCCAAGCCTACTCCTGCTCCCCGTGGTCGAACTACTGCTGCTCCATTGCCACAACAAAAACCTTGCCCGACTAGCGGTCTTACGATAACAAAAAACAGGGAAAAGAATAAACGCAAAAAATTGAAAAAAAAGGCAAGGAAAAAGGAAGAAAAAGCAAGAAGGGGCATACCAGAGCCTATAGTGCCGGATCCCCCATCGAGAACCCATGTCGAAACCATGGAGGTCTCTGAGGCCTCCCCACCAGCCCAATTATCGACAACAAGCCCGCAATTGCCTTCGGCCCATCCGGCCGAAGGGGCCGGGACGTACGGGCGTATTCTTACCCCTGCTGGGCGGCCGTTCAGGGGCACTGCGGCCCTTGTCAGGCGGGACGTGGTGCATGATCAGTTGGATTTGCTGTCCTTCACATCGACAAGGTCAGTCGGTGTGAGGTTACACACCTCGGGGGGAGATATGCGGATTTATGCCGCGTATAGACCCCCGGGGCCTGAATTCCACCCTGAGGATATAAGGCGGGCCCTGAATTACGACAGCCGCCCAGCTCTGCTGGTCGGGGACCTCAACGCGAAGCACGTCGCGTGGGGTTCCCGACTTAACACAGCAGTGGGCAGGCGGCTGTTAGAAGATGCCGATAGGGGCGACTACTCTGTGGTCGGCCCTGATGAACCCACGCACGTCCCGACCGCCGCGCGATACCAGCCCGATGTGCTGGACGTGTTTGACCCCAACACCCCTGAAGGGGTCGACGACGCGGCAGTCCGCCTTGTCGACTCCATCAGGGGAGCGATTGACCAGGCGACGACTCTTGTGCCCAGCGGCGGGCCTAGAGGTAGACTCCCGGCCCATCTGAAGGCGATCATTCCCCGGAAGAGGGGCCTGAGGAGGCTCTGGGCGACAACTCGTTGTCCCAGGATCAAGCGCGAGCTTAATGAGTTGGAAGCGGAGTTGGCGGCGAAGATTAGCTCCTTCCGGGGCTACACGTGGGAGGAACGGATTGAGGAGGCCCGTGAGGACCCCTCTTCTGTGTCCCTCCACCGACTTTGCCGCCAGTTCTCAAATCGGCCTGCCCTGACTTGTCCACTCCTGGACGAGAGGGGCAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATGTCCTGGCCGCAATGCTGGAGCGGCAGTTCGTTCCAAATGACTCTGCACCCTCAGAGGCCGCATTCCACCAATCGGTGGAAGAGAGCGTAGCGAACCTACTCTCCTCCCCGGTGCCACCGTTGGGAGATGATGTTTTCATCACTCCCAGTTAA
Protein
MVEALPNWSRHMAAIRERLGRAPSARPFGAGFRFLPTSVEEYRVVQAYLSEASARDGTIKWYCYALAEEMPSKVAVRGLPADTDEAEIVNALKELGFPARYARCIRSQRGRPGCVFHEALDHLSKDGLARLYAVNELLYLPGVTVEGWRPTRGPAQCHRCQAFGHASYNCHRAVRCVRCAGEHIVADCPRPRDGPFSCANCGKDHSAVDRRCAVYRKRARMMGVTVPPPAPQAPRAGSAALLASQPVPKWKGKGKGKSSQPPPLSHSAPSAVVVEASPSVSTLTAQANPPRQTTKSKPTPAPRGRTTAAPLPQQKPCPTSGLTITKNREKNKRKKLKKKARKKEEKARRGIPEPIVPDPPSRTHVETMEVSEASPPAQLSTTSPQLPSAHPAEGAGTYGRILTPAGRPFRGTAALVRRDVVHDQLDLLSFTSTRSVGVRLHTSGGDMRIYAAYRPPGPEFHPEDIRRALNYDSRPALLVGDLNAKHVAWGSRLNTAVGRRLLEDADRGDYSVVGPDEPTHVPTAARYQPDVLDVFDPNTPEGVDDAAVRLVDSIRGAIDQATTLVPSGGPRGRLPAHLKAIIPRKRGLRRLWATTRCPRIKRELNELEAELAAKISSFRGYTWEERIEEAREDPSSVSLHRLCRQFSNRPALTCPLLDERGNRCFSAQARADVLAAMLERQFVPNDSAPSEAAFHQSVEESVANLLSSPVPPLGDDVFITPS

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
722
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00092
Exp number, first 60 AAs:
0.00016
Total prob of N-in:
0.00015
outside
1  -  722
 
 

Population Genetic Test Statistics

Pi
219.677059
Theta
153.439321
Tajima's D
1.261362
CLR
0
CSRT
0.736163191840408
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号