SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05962
Pre Gene Modal
BGIBMGA002901
Annotation
gag-like_protein_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.533
 

Sequence

CDS
ATGCCTCATACTCTTCGTCTTCTGATGAGAGGTTCTTCAGCACCGCATCCATCAACAACGGGAGTCTCGTCACTCGCTGCATCGGTAGCATCAGGAACGAGCGGAGGGATAGACTCTGGCAAGCCGGGTGACTCTCTAGCCTGTGACCGAGTGATAAATATAGCTTTCTCTCGATCTGCGCACATTGCAAGTATGCTGCGATTGGTTGCTCTGTTAGGCTTGTTGTCGGCGGTGGCTGCCCGGTTGAGGATAGACCCGCTGGTTGATACTCAGCGGGGACTCATCAGGGGACTGAGGTCTGAAAATGGAAAGTTCGCGAAGTTTTTGGGCATACCGTACGCACTAGTTGATGAGAACAATCCTTTTGGGCCATCAGTACCACACCCTGGATTCGAAGAGACATTCGAAGCGTACGATGATTCCGTAGTTTGTCCTCAAGTTACTAAGGGCGTCGGAGTTGGTAGTCTCCAGTGTTTGAACCTGAACGTTTATGTCCCAAACACGGCTACATCGCGCAACAAGCGTCCCGTGATGATTTGGATTCACGGAGGAAGCTTCGCCACCGGCAGTGGGACAGGCAGGGACTTCTCCTACGACGACCTGGTCCGACATGACGTCATCGTTGTATCGGTCAACTACCGACTCGGACCCTACGGGTTCTTATGCTTGGACAGTCCTGATATTCCCGGCAACCAGGGTTTGAAGGATCAAGCTCTTGCTCTCAGATGGATTAAGGAAAATATCGAAGCGTTCGGCGGAGATGTCTCTAAAATAACCTTATTCGGAGAGAGTGCTGGCGGCGTCGCTGTCGATCTACACTTACTGACCGACAAAGATGAACTGTTCAATCAGGTGATCATTCAGAGTGGATCTGCTTTCTTTGCTGGGGGTATTAGAAAACCTAACAACCGTGTTCCAATAGAAATAGCGAGCCAACTGGGATTCGAAACTGATAACTTCGCAGAGGCGATAAAGTTTCTGGTCGATCAAGACCCCCACCTGGTGGTCGCAGCTAGCACTTCTCAAAGATCTACCTTAGGAGGCAATACTCTCAGACCTTGCCTAGAGAACAAATACGACGGAGTTGACAGTTTTCTTTCCGACTTTCCTGAAAATTTAAGGGCTAGAAACATTCCTGCTATTTATGGAGTAAACAATAAAGAATTTCTTACATTACATGCTTTTGTGACCCCAGAAGATTACGAGGTGACAGGAATTCGAGCTTTTCTGGAACGGGCTTTCAACTTGACCGATAGCGAGATGGAAGACCACGTGAGACATTTCTACATCGGAGACGAGACGCTGACCGAGAAGTTTTTCGATGAGTTTATAGATTTTGCATCGGACTATTACTACAACTACGGCGTCCAGCGGTCTATTAAGAAGTCATTGGCAGACGGTAACAAGGAGGTATATTACTATGTGTTCTCGTACGACGGAGGCAGGAATGCCATGAAGCAGTACCTCGGCATAACGGCGGAGGGCGCTGCGCACGCGGACGAGCTCGGCTACCTGCTGGCCGTGGATGCGGTCCCGGGACAACACATCGCCGAGGAGGACCAACTGATCATCGACAGGATCACTACTCTTTGGGCTAATTTTGCTAAATACGGGGTAGCCCCACCTGGGCACGTAGACATCATGGACGCTGTATTTGCGGAATTTCTCCGGCTTCGCTACCCAAAGCTCACTTCCGAGTTTCAGGCCTTCAAGGCCGATCACACTGCGAGCCCTCTCGTGGACTCCACCGAGCTCGCTGCTCCTGCGTCGCCTGTACCTGCGTGCAAAGCTTCTGCATCGAGCACCGCAGCCTCCGTCGTGCCTGCCGTTCCCGCGTCGCCTATACTGGCGAGTAAAACTGCTGCGTCGTCCGCCGTGGTCACCGTTCCAGCAGCGCGATCATCCGCGGCCTCCGTCGCGCCGTCCAAAACACCTACTCGTAGGTCACCTGCGCCCGCCTCCTCGTCCTCCGACTCTGACTCGGAGATGGAGGTCGACCTCGCTCCCGTCTCATCGACGGATGGATTCACCCTGGTGCAAAAGGGTAAGAAGCGTGCCGCGGAGTCTCGAGCTCCCGCGGCCGCTAAAATTAGCAAAGCCGCGAACGCGTCGCGCCCCCGCCCTCAGACTCCCGTTGCGCCTCCAGCCCGTGCCACTCCGTCGCCGCGTCCGGTGGCACAAAATAAAGCCCAGACCCCTCCCCCGGTAATCCTTCAAGAGAAGGCAGCTTGGGAACGAGTTTCCCTGGCCCTTAAGGCCAAAAATATCAATTTTACGAATGCCCGTAACCTCGCGAACGGCATTCAAATTAAGGTTCGAACATCCGACGACCATAGGGCCCTCTCTTCTTACCTCCGTAAGGAGCGTATAAGTTTCCACACATATACGCTCCAGGAGGAGCGCGAACTCCGTGCCGTTATACGTGGCATCCCTAAAGAGTTGGATGCCGAGCTCGTCAAGGCCGACCTTCTCGAACAAGGCCTACCGGTTAACTCCGTACACCGCATGCACACAGGCCGCGAAAGGGAGCCATATAATATGGTTCTCGTCGCCCTCCAGCCTACCCCCGAGGGTAAGCAAATATTCAACATCCGAACGGTCTGTAGCCTTTCCGGAATCGCAGTCGAAACCCCACACAAGAAAGGCACACCTAGCCAGTGCCATAACTGCCAATTATACGGGCATTCTTCCCGTAACTGTCACGCGCGCCCCCGATGCGTCAAGTGCTTAGGCGATCACGCCACGGCCCTATGCACTCGCGATCAAAAAACCGCGACAGAACCGCCTAGCTGCGTCCTGTGTCGAACACAGGGTCACCCCGCAAATTACCGCGGATGCCCCCGAGCCCCGAAAATAAATCGCCGCGTCGCCCGCCAAAACCGCCTCCGAGCTTCCGGCCCAGACATCAAAGCCTCGGCACCCTCTGTGTCGCAGGCTAAGCCAGCGTTCGTTCCGGCGCCGGTGCCCAGTGTCTCGGCCTGGGCGAAACCGCTGCCGTACATGAACACGGCTACAACTCCCTCCTCCGCGATTCGTCCCGCCCCCGCGACTCGTCCCTCTCCCGCGACTTGCCCTCCGACCGCGTCCGACAATCTCGCTTTAGCGATCGACTTCTTTCAGTCGATCAACTTTGAGCGCGTTAACGCTTTGGGCGACGCCATTCGCTCTGCCTCCACTGCACAACACTTTATCGCCGTTGTGCAAGAATACGCCGACGTATACGCGTCATTAAATACGTACGTCCTCCCCTCACTCCGCCGGTAA
Protein
MPHTLRLLMRGSSAPHPSTTGVSSLAASVASGTSGGIDSGKPGDSLACDRVINIAFSRSAHIASMLRLVALLGLLSAVAARLRIDPLVDTQRGLIRGLRSENGKFAKFLGIPYALVDENNPFGPSVPHPGFEETFEAYDDSVVCPQVTKGVGVGSLQCLNLNVYVPNTATSRNKRPVMIWIHGGSFATGSGTGRDFSYDDLVRHDVIVVSVNYRLGPYGFLCLDSPDIPGNQGLKDQALALRWIKENIEAFGGDVSKITLFGESAGGVAVDLHLLTDKDELFNQVIIQSGSAFFAGGIRKPNNRVPIEIASQLGFETDNFAEAIKFLVDQDPHLVVAASTSQRSTLGGNTLRPCLENKYDGVDSFLSDFPENLRARNIPAIYGVNNKEFLTLHAFVTPEDYEVTGIRAFLERAFNLTDSEMEDHVRHFYIGDETLTEKFFDEFIDFASDYYYNYGVQRSIKKSLADGNKEVYYYVFSYDGGRNAMKQYLGITAEGAAHADELGYLLAVDAVPGQHIAEEDQLIIDRITTLWANFAKYGVAPPGHVDIMDAVFAEFLRLRYPKLTSEFQAFKADHTASPLVDSTELAAPASPVPACKASASSTAASVVPAVPASPILASKTAASSAVVTVPAARSSAASVAPSKTPTRRSPAPASSSSDSDSEMEVDLAPVSSTDGFTLVQKGKKRAAESRAPAAAKISKAANASRPRPQTPVAPPARATPSPRPVAQNKAQTPPPVILQEKAAWERVSLALKAKNINFTNARNLANGIQIKVRTSDDHRALSSYLRKERISFHTYTLQEERELRAVIRGIPKELDAELVKADLLEQGLPVNSVHRMHTGREREPYNMVLVALQPTPEGKQIFNIRTVCSLSGIAVETPHKKGTPSQCHNCQLYGHSSRNCHARPRCVKCLGDHATALCTRDQKTATEPPSCVLCRTQGHPANYRGCPRAPKINRRVARQNRLRASGPDIKASAPSVSQAKPAFVPAPVPSVSAWAKPLPYMNTATTPSSAIRPAPATRPSPATCPPTASDNLALAIDFFQSINFERVNALGDAIRSASTAQHFIAVVQEYADVYASLNTYVLPSLRR

Summary

Uniprot
ProteinModelPortal
PDB
6EMI     E-value=1.02824e-44,     Score=458

Ontologies

Topology

Length:
1087
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.51971
Exp number, first 60 AAs:
0.11275
Total prob of N-in:
0.12002
outside
1  -  1087
 
 

Population Genetic Test Statistics

Pi
397.213003
Theta
195.097989
Tajima's D
2.949484
CLR
0.704518
CSRT
0.976751162441878
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号