SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05769
Annotation
gag-like_protein_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.271
 

Sequence

CDS
ATGGACGCTGTATTCGCGGAATTCCTCCGACTTCGCCACCCACAGCTCGCCTCAGAGTTTCTGGCCTTCAAGGCCAATCACACTGCGAGCCCTCTCGAGGACTCCGCCGCGCTCGCTGCTCCTGCGTCGCCTGTACCTGCGTGCAAAGCTTCTGCATCGAGCGCCGCAGCCTCCGTCGTGCCTGCCGCTCCCGTGTCGCCTATACTGGCGAGTAAAGCTACTGCGTCGTCCGCCGTGACCATCGTTTCTGCTGAGCGATCATCCGCGGCCTCCGTCGCGCCCTCTAAAACACCTACACTTGCTCGTAGGTCGCCTGCGCCCGCCTCCTCGTGCTCCGACTCTGACTCGGACATGGAGGTCGACCTCGCCCCAGCCTCATCGACGGATGGATTCACCCTGGTACAGAAGGGTAAGAAGCGTGCCGCGGAGTCTCGAGCTCCCGCGGCCGCTAAAATTAGCAAAGCCGCGAACGCGTCGCGCCCCCGCCCTCAGACTCCCGTTGCGCCCCCAGCCCGTGCCACTCCGTCGCCGCGTCCGGTGGCACAAAATAAAAGCCAGACCCTTCCCCCGGTTATCCTTCAGGAGAAGGCAGCTTGGAATCGAGTTTGCCTGGCCCTTAAGGCCAAAAATATTAATTTCACGAATGCCCGTAACCTCGTGAACGGCATTCAAATTAAGGTTCAAACACCCGACGACCATAGGACCCTCTCTTCTTACCTCCGTAAGAAGCGTATAAGTTTCCATGCGTATACGCTCCAGGAGGAGCGCGAACTCCGCGTTGTAATACGCGGAATCCCTAAAGAGTTAGATGTAGAGCTCGTCAAGGCCGATCTGTTAGAAGAGGGCTTACCAGTGAATTCTGTGCACCGTATGCACACCGGTCGCGGTAGGGAGCCATATCTAGTTCTAGTTCTAGTCTAG
Protein
MDAVFAEFLRLRHPQLASEFLAFKANHTASPLEDSAALAAPASPVPACKASASSAAASVVPAAPVSPILASKATASSAVTIVSAERSSAASVAPSKTPTLARRSPAPASSCSDSDSDMEVDLAPASSTDGFTLVQKGKKRAAESRAPAAAKISKAANASRPRPQTPVAPPARATPSPRPVAQNKSQTLPPVILQEKAAWNRVCLALKAKNINFTNARNLVNGIQIKVQTPDDHRTLSSYLRKKRISFHAYTLQEERELRVVIRGIPKELDVELVKADLLEEGLPVNSVHRMHTGRGREPYLVLVLV

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
306
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00135
Exp number, first 60 AAs:
0.00041
Total prob of N-in:
0.00815
outside
1  -  306
 
 

Population Genetic Test Statistics

Pi
62.634128
Theta
45.756041
Tajima's D
0.839336
CLR
97.911869
CSRT
0.619369031548423
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号