SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05485
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Full name
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.299
 

Sequence

CDS
ATGGCGCAGGCCAACCGGCCGCGGCGGACAAATAAACCCATTCCCGTTCCTCGTGGTCGCACTTCCGCTGGTGTCACACCTACACCTCGCCCGACCGGCGGTCCTGCACCCGGAAAAAATAGTAATAGGAACAAAAAGAAAAAACAAAAGAAAAAAGATAAAAAAAAAGAAGCACGAGAGAGAGAGGAAGCCATCAGAGCGACTGATGCTGCACCTCTCGAACAATCCCAAATGGTCGTTAAGACAATGGAGGTCAACGAGGCCTCCCCTACTGCCCAAACATCGAACTCCAATCCGCCATTGCCATCGGCCCATCTGGCCGAAGACAATTCTAATCTGAACAGCCAGCCCCCCCTTCCCCCCCGCCCTCAGCGCGAGCGCCGCAGCGGTCGACAGGCCTCTCAGCCTGCCGGCTTTGCTGCATGGCTGCTGGCACTCTGGGAGAACTTGGCCGAGGAGTACAACCCTGAGGTTCTGCTGCTGGGGGAGACCTTGTTAAAACCTCAGGATGTGTTCAGGATTCCCAACTATTTCATGTACCGACGTGACGAGCTTACCCCTGCCGGGCGGCCGTTCAGGGGCACTGCGGCCCTTGTCAGGCGGGACGTGGTGCATGATCAGTTGGATTTGCTGTCCTTCACATCGACAAGGTCAGTCGGTGTGAGGGTACACCCCGCGGGGGGAGATATGCGGATTTATGCCGCGTATAGACCCCCGGGGCCTGAATTCCATCCTGAGGATATAAGACGGGCCCTGAATTACGACAGCCGCCCAGCTCTGCTGGTCGGGGACCTCAACGCGAAGCACGTCGCGTGGGGTTCCCGACTTAACACAGCAGTGGGCAGGCGGCTGTTAGAAGATGCCGATAGGGGCGACTACTCTGTGGTCGGCCCTGATGAACCCACGCACGTCCCGACCGCCGCGCGATACCAGCCCGATGTGCTGGACGTGTGTGTTCATAAGGGGCTACGGTGCCCCGTAACGATCGAGGCACTGTACGACCTGGGTACCCCACATCTCCCTGTCCTGGTGACACTGGGAATGGGGCTCACCCGGGTTGCGACTTCGCCCCTACGACCGAAGGTCGACTGGGAGCTCTTTAAGAGACGACTAGTCGACCTTCCCGTAATTCAGGACCCCAACACCCCTGAGGGGGTCGACGACGCGGCAGTCCGCCTTGTCGACTCCATCAGGGGAGCGATTGACCAGGCGACGACTCTTGTGCCCAGCGGCGGGCCCAGAGGTAGACTCCCGGCCCATCTGAAGGCGATCATTCGCCGGAAGAGGGGCCTGAGGAGGCTCTGGGCGACAACTCGTTGTCCCAGGATCAAGCGCGAGCTTAATGAGTTGGAAGCGGAGTTGGCGGCGAAGATTAGCTCCTTTCGGGGCTATGCGTGGGAGGAACGGATTGAGGAGGCCCGTGAGGACCCCTCTTCCGTGTCCCTCCACCGACTTTGCCGCCAGCTCTCAAATCGGCCTGCCCCGACTTGTCCACTCGTGGACGAGAGGGGCAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATGTCCTGGCCGCAATGCTGGAGCGGCAGTTCATTCCGAATGACTCTGCACCCTCAGAGGCCGCATTCCACCAATCGGTGGAAGAGAGCGTAGCGAACCTACTCTCCTCCCCGGTGCCACCGTTGGGAGATGATGTTTTCATCACTCCCAGTGAATTGCGCCTCTCCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGTGAGGACGGTATTCCCTCCCTCGCATTCTTCCACTTCCCTGAAACGGTCGTGTCATACATGACACGGCTGTTCAATTCCATTCTGTCCACAGGACACTTCCCGGGAATTTGGAAATTGGGCAAGGTTATCGCCTTGCCCAAACCCGGCAAGGATAGGAGAAATCCCTCCAGTTACCGTCCGATCACCTTGCTGTCGCATGTGGGCAAGTTGTTCGAGAGGCTGCTGCTGAGAAGGGTGTCGCCGCACATCCTTCCCAGACCCGAGCAGTTCGGGTTTCGCAGCGGTCACTCGACAACGCTGCAATTGGTCCGCGTCATGCATCACTTGGCGGATCGGTCCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGATATCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGATCCACAAGCTGGTGCAGAACACGGACCTCCAGCACGCCTACGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCTTTGTCGCGGTCGAGGGCGCCAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCGCAGGGAAGCGTCCTGGCTCCACTCCTCTACGCTCTCTACACAAACGACATTCCCACGCTCGAGGGTAACCTCCAAGCGTGGGAAATAGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCTCGTCATCCAACGTCCCCTCTGCGGCCATTTTGAGGATGCAGAGGCTTTTGGACCTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACTGCGGCTATCCTCTTCGGTCCGGTCCGCACAACAGTCGTCCCGGGACAGCTCAGTCTCCGTGGCGCTAATGTCGAGTTTAGATCCAGCGTCCGGTACTTGGGGGTCGATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAATAAGGCGTTGGCGGCCGCTCGCTGTGCGAGATTCCTCCTCCGGCCATTGTTGGCCTCCAGGTTGCCGGTCAGGACTAAGCTCGGCATTTATAAGACGTATGTCCGTTCCCGTATCACGTACGCAGCTGAGGCCTGGTATCACCTCATCCCGCAGGGTATGCGGGCGAGGTTACAGGTCCAGCAAAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGAAATGACGTAATCGCCCGGGATCTAGATGTGGAGTCGCTCGAGGAGTTCATCCGGAGGCTAGCTCGTAATCTTTACGAGCGGGCTGACGGTGGACCCCACGAGCACCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTCGGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGGTAAGATAG
Protein
MAQANRPRRTNKPIPVPRGRTSAGVTPTPRPTGGPAPGKNSNRNKKKKQKKKDKKKEAREREEAIRATDAAPLEQSQMVVKTMEVNEASPTAQTSNSNPPLPSAHLAEDNSNLNSQPPLPPRPQRERRSGRQASQPAGFAAWLLALWENLAEEYNPEVLLLGETLLKPQDVFRIPNYFMYRRDELTPAGRPFRGTAALVRRDVVHDQLDLLSFTSTRSVGVRVHPAGGDMRIYAAYRPPGPEFHPEDIRRALNYDSRPALLVGDLNAKHVAWGSRLNTAVGRRLLEDADRGDYSVVGPDEPTHVPTAARYQPDVLDVCVHKGLRCPVTIEALYDLGTPHLPVLVTLGMGLTRVATSPLRPKVDWELFKRRLVDLPVIQDPNTPEGVDDAAVRLVDSIRGAIDQATTLVPSGGPRGRLPAHLKAIIRRKRGLRRLWATTRCPRIKRELNELEAELAAKISSFRGYAWEERIEEAREDPSSVSLHRLCRQLSNRPAPTCPLVDERGNRCFSAQARADVLAAMLERQFIPNDSAPSEAAFHQSVEESVANLLSSPVPPLGDDVFITPSELRLSIKRMKRRKAPGEDGIPSLAFFHFPETVVSYMTRLFNSILSTGHFPGIWKLGKVIALPKPGKDRRNPSSYRPITLLSHVGKLFERLLLRRVSPHILPRPEQFGFRSGHSTTLQLVRVMHHLADRSNARQYTAAVFLDIEKAFDRVWHAGLIHKLVQNTDLQHAYVRLLGSYLEGRSFFVAVEGAKSSVRPVTAGVPQGSVLAPLLYALYTNDIPTLEGNLQAWEIDVKLALFADDSAYFSSSNVPSAAILRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTTVVPGQLSLRGANVEFRSSVRYLGVDIDRSLRMTAHANKALAAARCARFLLRPLLASRLPVRTKLGIYKTYVRSRITYAAEAWYHLIPQGMRARLQVQQNLALRTIVGAGRYVRNDVIARDLDVESLEEFIRRLARNLYERADGGPHEHLHNIAPLHARPPDGRALPRELLEPPAMVR

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
RSAL01000708    RVE41206.1    NWSH01000895    PCG73652.1    ABLF02034467    ABLF02008153    + More
ABLF02008462    ABLF02008464    ABLF02023911    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GEZM01008457    JAV94772.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    NEVH01011985    PNF31054.1    NEVH01021205    PNF19912.1    ABLF02042518    ABLF02057746    ABLF02041767    NEVH01017470    PNF24199.1    GFTR01008279    JAW08147.1    GFTR01008262    JAW08164.1    NEVH01026386    PNF14434.1    GALX01005299    JAB63167.1    GBBI01004395    JAC14317.1    NEVH01008277    PNF34262.1    NEVH01007402    PNF35856.1    NEVH01016340    PNF25410.1    NEVH01015305    PNF27092.1    NEVH01021925    PNF19341.1    ABLF02028535    ABLF02028545    NEVH01023979    PNF17579.1    NEVH01001347    PNF42959.1    NEVH01005277    PNF39135.1    NEVH01020940    PNF20481.1    NEVH01006736    PNF36716.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    KQ973342    KXZ75569.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    NEVH01016302    PNF25823.1    KK119261    KFM75202.1    NWSH01000032    PCG80496.1    GGFL01004957    MBW69135.1    GBGD01000415    JAC88474.1    GALX01005359    JAB63107.1    GFXV01000908    MBW12713.1    GBBI01003810    JAC14902.1    KQ459265    KPJ02064.1    GGFL01005012    MBW69190.1    GFTR01008261    JAW08165.1    GGMS01002992    MBY72195.1    AB055391    BAB21761.1    GGMR01003407    MBY16026.1    GEZM01053022    JAV74219.1    GEZM01084969    JAV60363.1    AB018558    BAA76304.1    GGMR01006408    MBY19027.1    GBGD01000389    JAC88500.1    GFTR01008257    JAW08169.1    X17551    CAA35587.1    AY508487    AAS13459.1    GFTR01008254    JAW08172.1    GBBI01003747    JAC14965.1    GFTR01008246    JAW08180.1    KQ971729    KYB24751.1    GFTR01008038    JAW08388.1    NEVH01023280    PNF18085.1    LBMM01012041    KMQ86458.1    AY047531    AAK77263.1    AF081103    AAC72921.1    NWSH01007753    PCG62823.1    GFTR01008251    JAW08175.1    GGMS01017365    MBY86568.1    KK118005    KFM71947.1    GGMR01018716    MBY31335.1    GGMR01003864    MBY16483.1    ABLF02041861    M22874    M38643    NEVH01014858    PNF27387.1    U07847    AAA17752.1    GGFJ01001858    MBW50999.1    NEVH01007838    PNF34986.1    NEVH01019964    PNF22161.1    NEVH01002716    PNF41415.1    NEVH01006754    PNF36554.1    GGFJ01001857    MBW50998.1    GFTR01008269    JAW08157.1    GFTR01007929    JAW08497.1    GGMR01000676    MBY13295.1    GGFJ01001822    MBW50963.1    GFTR01008271    JAW08155.1    NEVH01022639    PNF18527.1    KU543687    AMS38379.1    KK113281    KFM59799.1    GFTR01008260    JAW08166.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF07727   RVT_2
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=3.57593e-05,     Score=117

Ontologies

Topology

Length:
1032
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0252499999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00113
outside
1  -  1032
 
 

Population Genetic Test Statistics

Pi
344.896669
Theta
230.290313
Tajima's D
2.039093
CLR
398.936348
CSRT
0.893405329733513
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号