SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03649
Pre Gene Modal
BGIBMGA014550
Annotation
gag-like_protein_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.569
 

Sequence

CDS
ATGGCTTTCTTCTGCAGCAGTGGCCAGAATTCAATATACAACTGGGTGAGGGATCACAGACTCCATCACAAGTTCGCCGACACCGATGCCGACCCTCACAACGTGAACCGAGGCTTCTTCTTCTCCCACATAGGATGGCTGATGATGAAGAAAAACGAAAGCGTCCTTACGAAAGGAAAGCTGATTGACATGAGTGACATAGAGAGCGATTCCCATTTGATGTTTCAACATAAGTATGATGTTACTTTTACCTTCGACCTTAGATTTAAGTTGTATCTTGGATGTCCGAGAAGTTGGGGCCTCGCCGCAAGGCGAGTGTTTTCAAGACCCGGGGCCGCCCCACCTGGGCACTCAGCGATCATGGACGCTGTATTCGCGGAATTCCTCCGACTTCGCCACCCACAGCTCGCCTCAGAGTTTCTGGCCTTCAAGGCCGATCACACCGCGAGCCCTCTCGTGGACTCCGCCGCGCTCGCTGCTCCTGCGTCGCCTGTACCTGCGTGCAAAGCTTCTGCATCGAGCACCGCAGCCTCCGTCGTGCCTGCCGTTCCCGCGTCGCCTATACTGGCGAGTAAAACTGCTGCGTCGTCCGCCGTGGCCACCGTTCCAGCAGCGCGATCATCCGCAGCCTCCGTCGTGCCCTCCAAAACACCTGCTCGTAGGTCACCTGCGCCCGCCTCCTCGTCCTCCGACTCTGACTCGGAGATGGAGGTCGACCTCGCTCCCGCCTCATCGACGGATGGATTCACCCTGGTACAAAAGGACCCCTCCCCGGTTATCCTTCAAGAGAAGGCAGCTTGGGATCGAGTTTCTCTGGCCCTTAAGGCCAAAAATATCAACTTCACGAATGCCCGTAACCTCGCGAACGGCATTCAAATTAAGGTTCGAACACCCGACGACCATAGGGCCCTCTCTTCTTACCTCCGTAAGGAACGTATAAGTTTCCACACGTATACGCTCCAGGAGGAGCGCGAACTCCGTGCCGTCATACGTGGCATCCCTAAAGAGTTGAATGCCGAGCTAGTCAAGGCCGACCTTCTCGAACAAGGCCTACCGGTTAACTCCGTACACCGCATGCACACAGGTCGCGGAAGGGAGCCATATAACATGGTTCTCGTCGCCCTCCAGCCTACCCCCGAGGGTAAGCAAATATTCAACATCCGAACGGTCTGTAGCCTTTCCGGAATCGCCGTCGAAACCCCACACAAGAAAGGCACACCTAGCCAGTGCCATAACTGCCAATTATACGGGCATTCTTCCCGTAACTGTCACGCGCGCCCCCGATGCGTCAAGTGTTTAGGAGATCACGCCACGGCCCTCTGCACTCGCGATCAAAAAACCGCGACGGAACCGCCTAGCTGCGTCCTGTGTCGTACACAGGGTCACCCCGCAAATTACCGCGGATGCCCCCGAGCCCCGAAAATAAATCGCCGCGTCGCCCGCCAAAACCGCCTCCGAGCTTCCGGCCCCGACATCAAAGCCTCGGCACCCTCTGTGTCGCAGGCTAAGCCAGCGTTCGATCCGGCGCCGGTGCCCAGTGTCTCGGCTTGGGCGAAACCGCTGCCGTACACGAACACGGTTACAACTCCCTCCTCCGCGATTCGTCCCGCCCCCGCAACTCGTCCCTCTCCCGCGACTTGCCCTCCGACCGCGTCCGACAATCTCGCTTTAGCGATCGACTTCTTTCAGTCGATCAACTTTGAGCGCGTTAACGCTTTGGGCGACGCCATTCGCGCTGCCTCCACTGCACAACACTTTATCGCCGTTGTGCAAGAATACGCCGACGTATACGCGTCATTAAATACGTACGTCCTCCCCTCACTCCGCCGGTAA
Protein
MAFFCSSGQNSIYNWVRDHRLHHKFADTDADPHNVNRGFFFSHIGWLMMKKNESVLTKGKLIDMSDIESDSHLMFQHKYDVTFTFDLRFKLYLGCPRSWGLAARRVFSRPGAAPPGHSAIMDAVFAEFLRLRHPQLASEFLAFKADHTASPLVDSAALAAPASPVPACKASASSTAASVVPAVPASPILASKTAASSAVATVPAARSSAASVVPSKTPARRSPAPASSSSDSDSEMEVDLAPASSTDGFTLVQKDPSPVILQEKAAWDRVSLALKAKNINFTNARNLANGIQIKVRTPDDHRALSSYLRKERISFHTYTLQEERELRAVIRGIPKELNAELVKADLLEQGLPVNSVHRMHTGRGREPYNMVLVALQPTPEGKQIFNIRTVCSLSGIAVETPHKKGTPSQCHNCQLYGHSSRNCHARPRCVKCLGDHATALCTRDQKTATEPPSCVLCRTQGHPANYRGCPRAPKINRRVARQNRLRASGPDIKASAPSVSQAKPAFDPAPVPSVSAWAKPLPYTNTVTTPSSAIRPAPATRPSPATCPPTASDNLALAIDFFQSINFERVNALGDAIRAASTAQHFIAVVQEYADVYASLNTYVLPSLRR

Summary

Uniprot
Pfam
PF07530   PRE_C2HC
Interpro
IPR006579   Pre_C2HC_dom       
ProteinModelPortal
PDB
4ZYO     E-value=1.41275e-22,     Score=265

Ontologies

GO

Topology

Length:
610
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01591
Exp number, first 60 AAs:
0.00066
Total prob of N-in:
0.00043
outside
1  -  610
 
 

Population Genetic Test Statistics

Pi
1.030513
Theta
1.198003
Tajima's D
-0.899541
CLR
149.059725
CSRT
0.162241887905605
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号